Protein Information |
Information Type | Description |
---|---|
Protein name | EXP02145 |
NCBI Accession ID | NC_016810.1 |
Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 |
Left | 2692789 |
Right | 2692866 |
Strand | - |
Nucleotide Sequence | GTGAAAAATCTGCATCACAAAGCTGAAAAGAAATCCGTTGAAATTCGTCAGACTCTCGTTCAGGAAACCCTTATCTGA |
Sequence | VKNLHHKAEKKSVEIRQTLVQETLI |
Source of smORF | Transcriptional-level |
Function | |
Pubmed ID | Venturini et al 2020 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 25 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 2695073 | 2695150 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
2 | 1432232 | 1432300 | + | NZ_CP060111.1 | Klebsiella michiganensis |
3 | 3406148 | 3406225 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
4 | 2685647 | 2685724 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
5 | 2670518 | 2670595 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
6 | 1068109 | 1068186 | + | NZ_CP061527.1 | Shigella dysenteriae |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00464.21 | 1.0 | 5 | 139.5 | same-strand | Serine hydroxymethyltransferase |
2 | PF00155.23 | 1.0 | 5 | 139 | same-strand | Aminotransferase class I and II |
3 | PF00175.23 | 1.0 | 5 | 111.0 | opposite-strand | Oxidoreductase NAD-binding domain |
4 | PF00042.24 | 1.0 | 5 | 111.0 | opposite-strand | Globin |
5 | PF00970.26 | 1.0 | 5 | 111.0 | opposite-strand | Oxidoreductase FAD-binding domain |
6 | PF02518.28 | 0.8 | 4 | 3947 | same-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
7 | PF00512.27 | 0.8 | 4 | 3947 | same-strand | His Kinase A (phospho-acceptor) domain |
8 | PF13942.8 | 0.8 | 4 | 3069 | same-strand | YfhG lipoprotein |
9 | PF00158.28 | 0.8 | 4 | 1745 | same-strand | Sigma-54 interaction domain |
10 | PF00072.26 | 0.8 | 4 | 1745 | same-strand | Response regulator receiver domain |
11 | PF14532.8 | 0.8 | 4 | 1745 | same-strand | Sigma-54 interaction domain |
12 | PF00004.31 | 0.8 | 4 | 1745 | same-strand | ATPase family associated with various cellular activities (AAA) |
13 | PF00543.24 | 0.8 | 4 | 1346 | same-strand | Nitrogen regulatory protein P-II |
14 | PF17128.6 | 0.8 | 4 | 3082 | same-strand | Domain of unknown function (DUF5107) |
15 | PF13432.8 | 0.8 | 4 | 3082 | same-strand | Tetratricopeptide repeat |
16 | PF13424.8 | 0.8 | 4 | 3082 | same-strand | Tetratricopeptide repeat |