Result : EXP02143
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02143 |
| NCBI Accession ID | NC_016810.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 |
| Left | 2513566 |
| Right | 2513637 |
| Strand | - |
| Nucleotide Sequence | ATGACCATAAATGAAATGCCCATAAAGAAATATTTCACGTTTCATCTCTCCGCGTACCTGTCGTACGCCTAA |
| Sequence | MTINEMPIKKYFTFHLSAYLSYA |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | Venturini et al 2020 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 23 |
++ More..
| Conservation Analysis |
No. of Species: 18
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2515849 | 2515920 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 484119 | 484190 | - | NZ_CP053416.1 | Salmonella bongori |
| 3 | 7677 | 7748 | + | NZ_CP038469.1 | Citrobacter tructae |
| 4 | 1188507 | 1188578 | - | NZ_CP033744.1 | Citrobacter freundii |
| 5 | 3907274 | 3907345 | + | NZ_CP044098.1 | Citrobacter portucalensis |
| 6 | 400439 | 400501 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 7 | 633013 | 633087 | + | NZ_CP011602.1 | Phytobacter ursingii |
| 8 | 1336806 | 1336883 | + | NZ_CP045845.1 | Kluyvera intermedia |
| 9 | 3652140 | 3652199 | - | NZ_CP043318.1 | Enterobacter chengduensis |
| 10 | 2618189 | 2618248 | - | NZ_CP017279.1 | Enterobacter ludwigii |
| 11 | 3445338 | 3445397 | - | NZ_CP009756.1 | Enterobacter cloacae |
| 12 | 3926302 | 3926361 | + | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
| 13 | 3364347 | 3364406 | - | NZ_CP017184.1 | Enterobacter roggenkampii |
| 14 | 3329501 | 3329560 | - | NZ_CP027986.1 | Enterobacter sichuanensis |
| 15 | 3329650 | 3329709 | - | NZ_AP022508.1 | Enterobacter bugandensis |
| 16 | 1963525 | 1963599 | + | NZ_CP051548.1 | Phytobacter diazotrophicus |
| 17 | 4320676 | 4320747 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 18 | 1373456 | 1373527 | + | NZ_LR134475.1 | Klebsiella aerogenes |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP038469.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03279.15 | 0.78 | 14 | 322.0 | opposite-strand | Bacterial lipid A biosynthesis acyltransferase |
| 2 | PF00155.23 | 1.0 | 18 | 100.0 | same-strand | Aminotransferase class I and II |
| 3 | PF02685.18 | 0.67 | 12 | 4200.5 | same-strand | Glucokinase |
| 4 | PF04397.17 | 0.89 | 16 | 3437.0 | opposite-strand | LytTr DNA-binding domain |
| 5 | PF00072.26 | 0.89 | 16 | 3437.0 | opposite-strand | Response regulator receiver domain |
| 6 | PF07694.14 | 0.89 | 16 | 1726.0 | opposite-strand | 5TMR of 5TMR-LYT |
| 7 | PF06580.15 | 0.89 | 16 | 1726.0 | opposite-strand | Histidine kinase |
| 8 | PF02518.28 | 0.89 | 16 | 1726.0 | opposite-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
++ More..