Result : EXP02142
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02142 |
| NCBI Accession ID | NC_016810.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 |
| Left | 2503581 |
| Right | 2503646 |
| Strand | - |
| Nucleotide Sequence | ATGCAGCAAGAAGAGAATGTCCTGGGTATCAATGGTGTCCCCTGCAGGAATCGAACCTGCAACTAG |
| Sequence | MQQEENVLGINGVPCRNRTCN |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | Venturini et al 2020 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 21 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2505864 | 2505929 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 3382664 | 3382729 | - | NZ_CP063425.1 | Kosakonia pseudosacchari |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00108.25 | 1.0 | 2 | 4334.5 | same-strand | Thiolase, N-terminal domain |
| 2 | PF02803.20 | 1.0 | 2 | 4334.5 | same-strand | Thiolase, C-terminal domain |
| 3 | PF04175.14 | 1.0 | 2 | 3880.0 | same-strand | Protein of unknown function (DUF406) |
| 4 | PF03349.18 | 1.0 | 2 | 2171.0 | opposite-strand | Outer membrane protein transport protein (OMPP1/FadL/TodX) |
| 5 | PF04333.15 | 1.0 | 2 | 1356.0 | same-strand | MlaA lipoprotein |
| 6 | PF01226.19 | 1.0 | 2 | 117.0 | opposite-strand | Formate/nitrite transporter |
++ More..