Result : EXP02128
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02128 |
| NCBI Accession ID | NC_016810.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 |
| Left | 822768 |
| Right | 822842 |
| Strand | - |
| Nucleotide Sequence | ATGAATTATTGCAAGATTCTCTGCTGCGTTAACCCGCGGCGGCGAACGCTTTTTATCCCTTATTTGAGGATTTGA |
| Sequence | MNYCKILCCVNPRRRTLFIPYLRI |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | Venturini et al 2020 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 24 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 823515 | 823589 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 3306508 | 3306579 | - | NZ_CP053416.1 | Salmonella bongori |
| 3 | 4465949 | 4466032 | + | NZ_CP021904.1 | Alkalitalea saponilacus |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02445.18 | 0.67 | 2 | 2236.0 | opposite-strand | Quinolinate synthetase A protein |
| 2 | PF04973.14 | 0.67 | 2 | 1492.0 | opposite-strand | Nicotinamide mononucleotide transporter |
| 3 | PF01545.23 | 0.67 | 2 | 557.0 | same-strand | Cation efflux family |
| 4 | PF13985.8 | 0.67 | 2 | 60.0 | same-strand | YbgS-like protein |
| 5 | PF00793.22 | 0.67 | 2 | 186.0 | opposite-strand | DAHP synthetase I family |
++ More..