Result : EXP02127
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02127 |
| NCBI Accession ID | NC_016810.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 |
| Left | 765368 |
| Right | 765421 |
| Strand | - |
| Nucleotide Sequence | ATGATGTTTGCCCACCGCAATAGTTTCGACTTTCATTTCTTTAATGCCCGGTAG |
| Sequence | MMFAHRNSFDFHFFNAR |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | Venturini et al 2020 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 17 |
++ More..
| Conservation Analysis |
No. of Species: 40
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2285631 | 2285684 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 2 | 767733 | 767786 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
| 3 | 3885835 | 3885888 | + | NZ_CP028271.1 | Mixta intestinalis |
| 4 | 244839 | 244892 | - | NZ_CP023529.1 | Lelliottia amnigena |
| 5 | 4178851 | 4178904 | + | NZ_CP045205.1 | Citrobacter telavivensis |
| 6 | 351245 | 351298 | + | NZ_CP042941.1 | Atlantibacter hermannii |
| 7 | 1438978 | 1439031 | - | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 8 | 3255810 | 3255863 | + | NZ_CP045845.1 | Kluyvera intermedia |
| 9 | 882503 | 882556 | - | NZ_LR134475.1 | Klebsiella aerogenes |
| 10 | 765960 | 766013 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 11 | 3241196 | 3241249 | - | NZ_CP053416.1 | Salmonella bongori |
| 12 | 2559476 | 2559529 | - | NZ_CP020388.1 | Pluralibacter gergoviae |
| 13 | 2184288 | 2184341 | + | NZ_CP045769.1 | Enterobacter cancerogenus |
| 14 | 3858426 | 3858479 | - | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 15 | 1291755 | 1291808 | - | NC_015968.1 | Enterobacter soli |
| 16 | 799105 | 799158 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 17 | 720718 | 720771 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 18 | 632714 | 632767 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 19 | 1465237 | 1465290 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 20 | 2107460 | 2107513 | + | NZ_CP027107.1 | Cronobacter sakazakii |
| 21 | 1360995 | 1361048 | - | NZ_CP012266.1 | Cronobacter dublinensis subsp. dublinensis LMG 23823 |
| 22 | 2729503 | 2729556 | + | NZ_CP012268.1 | Cronobacter muytjensii ATCC 51329 |
| 23 | 1534176 | 1534229 | - | NZ_CP043318.1 | Enterobacter chengduensis |
| 24 | 1357276 | 1357329 | - | NZ_CP009756.1 | Enterobacter cloacae |
| 25 | 1225250 | 1225303 | + | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
| 26 | 1286128 | 1286181 | - | NZ_CP017184.1 | Enterobacter roggenkampii |
| 27 | 1330076 | 1330129 | - | NZ_CP027986.1 | Enterobacter sichuanensis |
| 28 | 1337517 | 1337570 | - | NZ_AP022508.1 | Enterobacter bugandensis |
| 29 | 515914 | 515967 | - | NZ_CP017279.1 | Enterobacter ludwigii |
| 30 | 700518 | 700571 | - | NZ_AP014857.1 | Escherichia albertii |
| 31 | 2824456 | 2824509 | + | NZ_CP013940.1 | Cronobacter malonaticus LMG 23826 |
| 32 | 1316588 | 1316641 | - | NZ_CP012264.1 | Cronobacter condimenti 1330 |
| 33 | 1316716 | 1316769 | - | NZ_CP012257.1 | Cronobacter universalis NCTC 9529 |
| 34 | 1403651 | 1403704 | - | NZ_CP023706.1 | Edwardsiella tarda |
| 35 | 2211720 | 2211773 | - | NZ_CP023706.1 | Edwardsiella tarda |
| 36 | 498875 | 498928 | - | NZ_CP016043.1 | Edwardsiella hoshinae |
| 37 | 3434429 | 3434482 | - | NZ_CP016043.1 | Edwardsiella hoshinae |
| 38 | 2035645 | 2035698 | + | NZ_CP006664.1 | Edwardsiella anguillarum ET080813 |
| 39 | 1197976 | 1198029 | + | NZ_CP006664.1 | Edwardsiella anguillarum ET080813 |
| 40 | 3530985 | 3531038 | + | NZ_CP023525.1 | Cedecea neteri |
| 41 | 410917 | 410970 | + | NZ_CP050150.1 | Hafnia alvei |
| 42 | 789527 | 789580 | + | NZ_CP011118.1 | Yersinia enterocolitica |
| 43 | 3296924 | 3296977 | + | NC_012779.2 | Edwardsiella ictaluri 93-146 |
| 44 | 365199 | 365255 | - | NC_010554.1 | Proteus mirabilis HI4320 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_013716.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00702.28 | 0.75 | 30 | 4280 | same-strand | haloacid dehalogenase-like hydrolase |
| 2 | PF00122.22 | 0.75 | 30 | 4280 | same-strand | E1-E2 ATPase |
| 3 | PF02669.17 | 0.78 | 31 | 3692.0 | same-strand | K+-transporting ATPase, c chain |
| 4 | PF02702.19 | 0.78 | 31 | 1004.0 | same-strand | Osmosensitive K+ channel His kinase sensor domain |
| 5 | PF13493.8 | 0.78 | 31 | 1004.0 | same-strand | Domain of unknown function (DUF4118) |
| 6 | PF02518.28 | 0.78 | 31 | 1004.0 | same-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
| 7 | PF00512.27 | 0.78 | 31 | 1004.0 | same-strand | His Kinase A (phospho-acceptor) domain |
| 8 | PF00072.26 | 0.8 | 32 | 330 | same-strand | Response regulator receiver domain |
| 9 | PF00486.30 | 0.78 | 31 | 330.0 | same-strand | Transcriptional regulatory protein, C terminal |
| 10 | PF01276.22 | 0.95 | 38 | 268 | same-strand | Orn/Lys/Arg decarboxylase, major domain |
| 11 | PF03711.17 | 0.97 | 39 | 268.0 | same-strand | Orn/Lys/Arg decarboxylase, C-terminal domain |
| 12 | PF03709.17 | 0.97 | 39 | 268.0 | same-strand | Orn/Lys/Arg decarboxylase, N-terminal domain |
| 13 | PF13520.8 | 0.97 | 39 | 2462 | same-strand | Amino acid permease |
| 14 | PF00324.23 | 0.97 | 39 | 2460.5 | same-strand | Amino acid permease |
| 15 | PF02878.18 | 0.72 | 29 | 3870 | opposite-strand | Phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain I |
| 16 | PF02880.18 | 0.72 | 29 | 3870 | opposite-strand | Phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain III |
| 17 | PF02879.18 | 0.72 | 29 | 3870 | opposite-strand | Phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain II |
| 18 | PF00408.22 | 0.72 | 29 | 3870 | opposite-strand | Phosphoglucomutase/phosphomannomutase, C-terminal domain |
| 19 | PF03925.15 | 0.72 | 29 | 5535 | opposite-strand | SeqA protein C-terminal domain |
| 20 | PF17206.5 | 0.72 | 29 | 5535 | opposite-strand | SeqA protein N-terminal domain |
| 21 | PF03814.17 | 0.65 | 26 | 6347 | same-strand | Potassium-transporting ATPase A subunit |
++ More..