ProsmORF-pred
Result : EXP02123
Protein Information
Information Type Description
Protein name EXP02123
NCBI Accession ID NC_016810.1
Organism Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344
Left 4407945
Right 4408019
Strand +
Nucleotide Sequence GTGGCTATCGGTGCGTGTATGCAGGAGAGTGCTTTTCTGGCATTTCCGTCGCACTCGATGCTTAGCAAGCGATAA
Sequence VAIGACMQESAFLAFPSHSMLSKR
Source of smORF Transcriptional-level
Function
Pubmed ID Venturini et al 2020
Domain
Functional Category Function not yet assigned
Uniprot ID
ORF Length (Amino Acid) 24
++ More..
Conservation Analysis
Conservation Analysis
No. of Species: 75
Sr.No. Left Position Right Position Strand NCBI Accession id Species Name
1 160608 160682 - NZ_CP051548.1 Phytobacter diazotrophicus
2 2153056 2153130 + NZ_CP053416.1 Salmonella bongori
3 838941 839015 + NZ_CP045205.1 Citrobacter telavivensis
4 3943561 3943635 - NC_013716.1 Citrobacter rodentium ICC168
5 832436 832510 - NZ_LT556085.1 Citrobacter amalonaticus
6 2767306 2767380 - NC_009792.1 Citrobacter koseri ATCC BAA-895
7 4386627 4386701 + NC_003197.2 Salmonella enterica subsp. enterica serovar Typhimurium str. LT2
8 4301590 4301664 - NZ_CP054058.1 Scandinavium goeteborgense
9 4922139 4922213 - NZ_LR134475.1 Klebsiella aerogenes
10 4241633 4241707 - NZ_AP023184.1 Buttiauxella agrestis
11 2966966 2967040 + NZ_CP033744.1 Citrobacter freundii
12 2103997 2104071 - NZ_CP044098.1 Citrobacter portucalensis
13 3135352 3135426 - NZ_CP038469.1 Citrobacter tructae
14 5252243 5252317 - NZ_CP054254.1 Klebsiella variicola
15 249618 249692 + NC_016845.1 Klebsiella pneumoniae subsp. pneumoniae HS11286
16 4962729 4962803 - NZ_CP065838.1 Klebsiella quasipneumoniae
17 489361 489435 - NZ_CP020388.1 Pluralibacter gergoviae
18 5009138 5009212 + NC_002695.2 Escherichia coli O157:H7 str. Sakai
19 4171638 4171712 + NZ_AP014857.1 Escherichia albertii
20 4200186 4200260 + NC_000913.3 Escherichia coli str. K-12 substr. MG1655
21 4219167 4219241 + NC_004337.2 Shigella flexneri 2a str. 301
22 3142299 3142373 + NZ_CP057657.1 Escherichia fergusonii
23 239154 239228 + NZ_LR134340.1 Escherichia marmotae
24 133457 133531 + NZ_CP061527.1 Shigella dysenteriae
25 4283087 4283161 - NZ_CP011602.1 Phytobacter ursingii
26 4402987 4403061 - NZ_CP035129.1 Kosakonia cowanii
27 5601801 5601875 + NZ_CP015113.1 Kosakonia radicincitans
28 5123788 5123862 - NZ_CP014007.2 Kosakonia oryzae
29 2884322 2884396 - NZ_CP045300.1 Kosakonia arachidis
30 253633 253707 + NZ_CP043318.1 Enterobacter chengduensis
31 243055 243129 + NZ_CP012871.1 [Enterobacter] lignolyticus
32 5868080 5868154 - NZ_CP060111.1 Klebsiella michiganensis
33 3465795 3465869 + NZ_CP017279.1 Enterobacter ludwigii
34 2363716 2363790 - NZ_CP025034.2 Enterobacter sp. SGAir0187
35 238739 238813 + NZ_CP017184.1 Enterobacter roggenkampii
36 240803 240877 + NZ_CP027986.1 Enterobacter sichuanensis
37 369800 369874 + NZ_CP012266.1 Cronobacter dublinensis subsp. dublinensis LMG 23823
38 3668084 3668158 - NZ_CP012268.1 Cronobacter muytjensii ATCC 51329
39 375936 376010 + NZ_CP012264.1 Cronobacter condimenti 1330
40 360794 360868 + NZ_CP012257.1 Cronobacter universalis NCTC 9529
41 3790894 3790968 - NZ_CP013940.1 Cronobacter malonaticus LMG 23826
42 3070803 3070877 - NZ_CP027107.1 Cronobacter sakazakii
43 254094 254168 + NZ_CP063425.1 Kosakonia pseudosacchari
44 3409472 3409546 + NZ_CP016337.1 Kosakonia sacchari
45 4566623 4566697 - NZ_CP013990.1 Leclercia adecarboxylata
46 1416339 1416413 - NZ_CP042941.1 Atlantibacter hermannii
47 1535133 1535207 + NZ_CP040428.1 Jejubacter calystegiae
48 276780 276854 + NZ_CP042220.2 Dickeya poaceiphila
49 3594700 3594774 - NZ_CP065534.1 Lonsdalea populi
50 3299159 3299233 - NZ_CP045769.1 Enterobacter cancerogenus
51 224573 224647 + NZ_AP022508.1 Enterobacter bugandensis
52 2736989 2737063 + NZ_AP019007.1 Enterobacter oligotrophicus
53 3737985 3738059 + NZ_CP023529.1 Lelliottia amnigena
54 252602 252676 + NC_015968.1 Enterobacter soli
55 2496133 2496207 - NZ_CP009460.1 Dickeya fangzhongdai
56 273844 273918 + NC_014500.1 Dickeya dadantii 3937
57 284202 284276 + NZ_CP025799.1 Dickeya zeae
58 318231 318305 + NZ_LT615367.1 Dickeya aquatica
59 5298289 5298363 - NZ_CP046672.1 Raoultella ornithinolytica
60 2012402 2012476 + NZ_CP026047.1 Raoultella planticola
61 5000828 5000902 - NZ_CP041247.1 Raoultella electrica
62 5810604 5810678 - NZ_CP036175.1 Klebsiella huaxiensis
63 3915725 3915799 - NZ_CP014137.1 Brenneria goodwinii
64 3838504 3838578 - NC_017910.1 Shimwellia blattae DSM 4481 = NBRC 105725
65 4401826 4401900 - NZ_CP045845.1 Kluyvera intermedia
66 2443503 2443577 + NZ_CP015137.1 Dickeya solani IPO 2222
67 4370108 4370182 - NC_012912.1 Dickeya chrysanthemi Ech1591
68 3672378 3672452 - NZ_CP034035.1 Brenneria rubrifaciens
69 266820 266894 + NZ_CP009756.1 Enterobacter cloacae
70 1348067 1348141 + NZ_CP023009.1 Lonsdalea britannica
71 4499712 4499786 - NZ_CP034036.1 Brenneria nigrifluens DSM 30175 = ATCC 13028
72 438491 438565 + NC_012962.1 Photorhabdus asymbiotica
73 531530 531604 + NC_005126.1 Photorhabdus laumondii subsp. laumondii TTO1
74 1432920 1432994 - NZ_CP011104.1 Photorhabdus thracensis
75 183788 183850 + NC_012779.2 Edwardsiella ictaluri 93-146
76 4497369 4497431 - NZ_CP006569.1 Sodalis praecaptivus
++ More..
Neighborhood Conservation Analysis
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Conservation Analysis
Neighborhood Representative Chosen(Species): NC_009792.1
Sr.No. Domain Co-occurrence Frequency No. of species in which domain occurs with smORF Median distance b/w smORF and domain bearing ORFs Orientation relative to smORF PFAM Information
1 PF07356.14 1.0 75 305.5 same-strand Protein of unknown function (DUF1481)
2 PF00216.23 1.0 75 21.0 same-strand Bacterial DNA-binding protein
3 PF04222.14 1.0 75 92.0 same-strand Protein of unknown function (DUF416)
4 PF04493.16 1.0 75 725.0 same-strand Endonuclease V
5 PF01208.19 1.0 75 1406.0 same-strand Uroporphyrinogen decarboxylase (URO-D)
6 PF00293.30 0.99 74 2512 same-strand NUDIX domain
7 PF09297.13 0.99 74 2512 same-strand NADH pyrophosphatase zinc ribbon domain
8 PF04353.15 0.87 65 3380.0 opposite-strand Regulator of RNA polymerase sigma(70) subunit, Rsd/AlgQ
9 PF01808.20 0.65 49 2376 opposite-strand AICARFT/IMPCHase bienzyme
10 PF02142.24 0.65 49 2376 opposite-strand MGS-like domain
11 PF01071.21 0.67 50 1065.5 opposite-strand Phosphoribosylglycinamide synthetase, ATP-grasp (A) domain
12 PF02844.17 0.67 50 1065.5 opposite-strand Phosphoribosylglycinamide synthetase, N domain
13 PF02843.18 0.65 49 1065 opposite-strand Phosphoribosylglycinamide synthetase, C domain
14 PF02655.16 0.67 50 1065.5 opposite-strand ATP-grasp domain
++ More..