Result : EXP02121
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02121 |
| NCBI Accession ID | NC_016810.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 |
| Left | 4230416 |
| Right | 4230493 |
| Strand | + |
| Nucleotide Sequence | ATGGGTATTAGAATTCCCTATGTAAAGAATGAAAAAAAATTACGAAAAGGTCTTTCTGTGTTGCTCAAAAAAGAGTAA |
| Sequence | MGIRIPYVKNEKKLRKGLSVLLKKE |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | Venturini et al 2020 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 25 |
++ More..
| Conservation Analysis |
No. of Species: 34
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4208991 | 4209068 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 2010582 | 2010659 | + | NZ_CP053416.1 | Salmonella bongori |
| 3 | 2822352 | 2822429 | + | NZ_CP033744.1 | Citrobacter freundii |
| 4 | 1057201 | 1057278 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 5 | 3282177 | 3282254 | - | NZ_CP038469.1 | Citrobacter tructae |
| 6 | 2268008 | 2268085 | - | NZ_CP044098.1 | Citrobacter portucalensis |
| 7 | 617154 | 617231 | + | NZ_CP045205.1 | Citrobacter telavivensis |
| 8 | 4110783 | 4110860 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
| 9 | 3630151 | 3630231 | + | NZ_CP045769.1 | Enterobacter cancerogenus |
| 10 | 4738100 | 4738177 | - | NC_015968.1 | Enterobacter soli |
| 11 | 2508504 | 2508584 | + | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 12 | 4683280 | 4683357 | + | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 13 | 4631984 | 4632061 | - | NZ_CP045845.1 | Kluyvera intermedia |
| 14 | 3176781 | 3176861 | - | NZ_CP017279.1 | Enterobacter ludwigii |
| 15 | 4792917 | 4792997 | - | NZ_CP009756.1 | Enterobacter cloacae |
| 16 | 4572888 | 4572968 | - | NZ_AP022508.1 | Enterobacter bugandensis |
| 17 | 5048520 | 5048600 | - | NZ_CP043318.1 | Enterobacter chengduensis |
| 18 | 2640345 | 2640425 | + | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
| 19 | 4671458 | 4671538 | - | NZ_CP017184.1 | Enterobacter roggenkampii |
| 20 | 4653278 | 4653358 | - | NZ_CP027986.1 | Enterobacter sichuanensis |
| 21 | 4020225 | 4020302 | + | NZ_AP014857.1 | Escherichia albertii |
| 22 | 28462 | 28542 | + | NZ_CP063425.1 | Kosakonia pseudosacchari |
| 23 | 3180506 | 3180586 | + | NZ_CP016337.1 | Kosakonia sacchari |
| 24 | 5373733 | 5373813 | + | NZ_CP015113.1 | Kosakonia radicincitans |
| 25 | 417232 | 417312 | - | NZ_CP051548.1 | Phytobacter diazotrophicus |
| 26 | 32877 | 32939 | + | NZ_CP013990.1 | Leclercia adecarboxylata |
| 27 | 3114997 | 3115077 | - | NZ_CP045300.1 | Kosakonia arachidis |
| 28 | 4512746 | 4512823 | - | NZ_CP054058.1 | Scandinavium goeteborgense |
| 29 | 4845891 | 4845968 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 30 | 4062499 | 4062576 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 31 | 2704785 | 2704862 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 32 | 3426946 | 3427026 | - | NZ_CP023529.1 | Lelliottia amnigena |
| 33 | 5356491 | 5356571 | - | NZ_CP014007.2 | Kosakonia oryzae |
| 34 | 4049811 | 4049888 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 35 | 4285479 | 4285556 | - | NZ_LR134340.1 | Escherichia marmotae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP053416.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF06288.15 | 0.82 | 28 | 5902.0 | same-strand | Protein of unknown function (DUF1040) |
| 2 | PF01636.25 | 0.91 | 31 | 4855 | same-strand | Phosphotransferase enzyme family |
| 3 | PF01323.22 | 1.0 | 34 | 4212 | same-strand | DSBA-like thioredoxin domain |
| 4 | PF13462.8 | 1.0 | 34 | 4212 | same-strand | Thioredoxin |
| 5 | PF01553.23 | 0.97 | 33 | 3244.0 | opposite-strand | Acyltransferase |
| 6 | PF00476.22 | 1.0 | 34 | 60 | same-strand | DNA polymerase family A |
| 7 | PF02739.18 | 1.0 | 34 | 60 | same-strand | 5'-3' exonuclease, N-terminal resolvase-like domain |
| 8 | PF01612.22 | 1.0 | 34 | 60 | same-strand | 3'-5' exonuclease |
| 9 | PF01367.22 | 1.0 | 34 | 60 | same-strand | 5'-3' exonuclease, C-terminal SAM fold |
| 10 | PF01926.25 | 1.0 | 34 | 176 | opposite-strand | 50S ribosome-binding GTPase |
| 11 | PF02421.20 | 1.0 | 34 | 176 | opposite-strand | Ferrous iron transport protein B |
| 12 | PF04220.14 | 0.97 | 33 | 1387.0 | same-strand | Der GTPase activator (YihI) |
| 13 | PF04055.23 | 1.0 | 34 | 2089 | same-strand | Radical SAM superfamily |
| 14 | PF06969.18 | 1.0 | 34 | 2089 | same-strand | HemN C-terminal domain |
| 15 | PF00158.28 | 0.91 | 31 | 3760.0 | opposite-strand | Sigma-54 interaction domain |
| 16 | PF00072.26 | 0.91 | 31 | 3760.0 | opposite-strand | Response regulator receiver domain |
| 17 | PF14532.8 | 0.91 | 31 | 3760.0 | opposite-strand | Sigma-54 interaction domain |
| 18 | PF02954.21 | 0.91 | 31 | 3760.0 | opposite-strand | Bacterial regulatory protein, Fis family |
| 19 | PF07728.16 | 0.91 | 31 | 3760.0 | opposite-strand | AAA domain (dynein-related subfamily) |
++ More..