Result : EXP02120
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02120 |
| NCBI Accession ID | NC_016810.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 |
| Left | 4196238 |
| Right | 4196321 |
| Strand | + |
| Nucleotide Sequence | GTGCAATGCCTGGCGATATTGATTATTTATTGTGATGAACATCACTTTTTAATGGTAAGCGAGTGCAATTGTTTTACGTCATAG |
| Sequence | VQCLAILIIYCDEHHFLMVSECNCFTS |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | Venturini et al 2020 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 27 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4174706 | 4174789 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 1978700 | 1978783 | + | NZ_CP053416.1 | Salmonella bongori |
| 3 | 164604 | 164690 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP053416.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00892.22 | 1.0 | 3 | 4551 | same-strand | EamA-like transporter family |
| 2 | PF03466.22 | 1.0 | 3 | 3710 | opposite-strand | LysR substrate binding domain |
| 3 | PF00126.29 | 1.0 | 3 | 3710 | opposite-strand | Bacterial regulatory helix-turn-helix protein, lysR family |
| 4 | PF01717.20 | 1.0 | 3 | 1213 | same-strand | Cobalamin-independent synthase, Catalytic domain |
| 5 | PF08267.14 | 1.0 | 3 | 1213 | same-strand | Cobalamin-independent synthase, N-terminal domain |
| 6 | PF01738.20 | 1.0 | 3 | 88 | opposite-strand | Dienelactone hydrolase family |
| 7 | PF01048.22 | 1.0 | 3 | 88 | same-strand | Phosphorylase superfamily |
| 8 | PF02646.18 | 1.0 | 3 | 989 | same-strand | RmuC family |
| 9 | PF01209.20 | 1.0 | 3 | 2515 | same-strand | ubiE/COQ5 methyltransferase family |
| 10 | PF13649.8 | 1.0 | 3 | 2515 | same-strand | Methyltransferase domain |
| 11 | PF08241.14 | 1.0 | 3 | 2515 | same-strand | Methyltransferase domain |
| 12 | PF13847.8 | 1.0 | 3 | 2515 | same-strand | Methyltransferase domain |
| 13 | PF13489.8 | 1.0 | 3 | 2515 | same-strand | Methyltransferase domain |
| 14 | PF08242.14 | 1.0 | 3 | 2515 | same-strand | Methyltransferase domain |
| 15 | PF02036.19 | 1.0 | 3 | 3280 | same-strand | SCP-2 sterol transfer family |
| 16 | PF03109.18 | 1.0 | 3 | 3882 | same-strand | ABC1 atypical kinase-like domain |
| 17 | PF08282.14 | 0.67 | 2 | 5428.5 | same-strand | haloacid dehalogenase-like hydrolase |
++ More..