Protein Information |
Information Type | Description |
---|---|
Protein name | EXP02115 |
NCBI Accession ID | NC_016810.1 |
Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 |
Left | 3671569 |
Right | 3671631 |
Strand | + |
Nucleotide Sequence | ATGATTTGCCTTCACTGGGATGCGCTTTACAATGCTCAAGTTCAACTCCACGCTTGCCGATAG |
Sequence | MICLHWDALYNAQVQLHACR |
Source of smORF | Transcriptional-level |
Function | |
Pubmed ID | Venturini et al 2020 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 20 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 3650058 | 3650120 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
2 | 1499193 | 1499255 | + | NZ_CP053416.1 | Salmonella bongori |
3 | 2425926 | 2425988 | + | NZ_CP057657.1 | Escherichia fergusonii |
4 | 4418913 | 4418975 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
5 | 3482000 | 3482062 | + | NZ_AP014857.1 | Escherichia albertii |
6 | 4009819 | 4009881 | + | NZ_LR134340.1 | Escherichia marmotae |
7 | 2764410 | 2764472 | - | NZ_CP044098.1 | Citrobacter portucalensis |
8 | 2311667 | 2311729 | + | NZ_CP033744.1 | Citrobacter freundii |
9 | 4238656 | 4238718 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
10 | 3526334 | 3526396 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
11 | 3495548 | 3495610 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
12 | 183442 | 183504 | + | NZ_CP061527.1 | Shigella dysenteriae |
13 | 172192 | 172248 | + | NZ_CP064030.1 | Dyella caseinilytica |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00912.24 | 0.92 | 11 | 865.5 | same-strand | Transglycosylase |
2 | PF17092.7 | 0.92 | 11 | 865.5 | same-strand | Penicillin-binding protein OB-like domain |
3 | PF00293.30 | 0.92 | 11 | 185.0 | opposite-strand | NUDIX domain |
4 | PF07095.13 | 0.92 | 11 | 75.0 | same-strand | Intracellular growth attenuator protein IgaA |
5 | PF13419.8 | 0.92 | 11 | 2273.0 | same-strand | Haloacid dehalogenase-like hydrolase |
6 | PF01479.27 | 0.92 | 11 | 2952.0 | same-strand | S4 domain |
7 | PF01430.21 | 0.92 | 11 | 3378.0 | same-strand | Hsp33 protein |
8 | PF13687.8 | 0.67 | 8 | 4361 | opposite-strand | Domain of unknown function (DUF4153) |