Result : EXP02114
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02114 |
| NCBI Accession ID | NC_016810.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 |
| Left | 3342897 |
| Right | 3342986 |
| Strand | + |
| Nucleotide Sequence | ATGGACATATATGCAGACAATTTCCGTGGAAAAGTCTGCGTTTGTTGCGTCCGGGATCAAGGCATCCCGGACGATTCAGGAGTACAATAG |
| Sequence | MDIYADNFRGKVCVCCVRDQGIPDDSGVQ |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | Venturini et al 2020 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 29 |
++ More..
| Conservation Analysis |
No. of Species: 7
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3322201 | 3322290 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 1179676 | 1179765 | + | NZ_CP053416.1 | Salmonella bongori |
| 3 | 4074721 | 4074810 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 4 | 1989065 | 1989154 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 5 | 5113869 | 5113958 | + | NZ_CP045205.1 | Citrobacter telavivensis |
| 6 | 3745975 | 3746052 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 7 | 875746 | 875841 | + | NZ_CP040602.1 | Thiomicrorhabdus sediminis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02472.18 | 0.86 | 6 | 2191.0 | opposite-strand | Biopolymer transport protein ExbD/TolR |
| 2 | PF01618.18 | 0.86 | 6 | 1450.0 | opposite-strand | MotA/TolQ/ExbB proton channel family |
| 3 | PF01053.22 | 0.86 | 6 | 12.0 | same-strand | Cys/Met metabolism PLP-dependent enzyme |
| 4 | PF09335.13 | 0.86 | 6 | 39.0 | same-strand | SNARE associated Golgi protein |
| 5 | PF06719.15 | 0.86 | 6 | 756.0 | opposite-strand | AraC-type transcriptional regulator N-terminus |
| 6 | PF12833.9 | 0.86 | 6 | 748.5 | opposite-strand | Helix-turn-helix domain |
| 7 | PF00165.25 | 0.71 | 5 | 750 | opposite-strand | Bacterial regulatory helix-turn-helix proteins, AraC family |
| 8 | PF00465.21 | 0.71 | 5 | 1842 | same-strand | Iron-containing alcohol dehydrogenase |
++ More..