Result : EXP02111
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02111 |
| NCBI Accession ID | NC_016810.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 |
| Left | 2953686 |
| Right | 2953748 |
| Strand | + |
| Nucleotide Sequence | ATGAAAAATAACGCACTTACCGGGAAGAATATACTCTCAGGAGATAAAATGCTTCGGCAATGA |
| Sequence | MKNNALTGKNILSGDKMLRQ |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | Venturini et al 2020 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 20 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2931114 | 2931176 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 755759 | 755821 | + | NZ_CP053416.1 | Salmonella bongori |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF04393.15 | 1.0 | 2 | 1302.5 | same-strand | Protein of unknown function (DUF535) |
| 2 | PF03824.18 | 1.0 | 2 | 41.0 | opposite-strand | High-affinity nickel-transport protein |
| 3 | PF08521.12 | 1.0 | 2 | 1187.0 | opposite-strand | Two-component sensor kinase N-terminal |
| 4 | PF02518.28 | 1.0 | 2 | 1187.0 | opposite-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
| 5 | PF00672.27 | 1.0 | 2 | 1187.0 | opposite-strand | HAMP domain |
| 6 | PF00512.27 | 1.0 | 2 | 1187.0 | opposite-strand | His Kinase A (phospho-acceptor) domain |
| 7 | PF00072.26 | 1.0 | 2 | 2590.5 | opposite-strand | Response regulator receiver domain |
| 8 | PF00486.30 | 1.0 | 2 | 2590.5 | opposite-strand | Transcriptional regulatory protein, C terminal |
| 9 | PF07331.13 | 1.0 | 2 | 4411.5 | same-strand | Tripartite tricarboxylate transporter TctB family |
++ More..