Result : B3PLV3
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | ATP synthase subunit c (ATP synthase F(0) sector subunit c) (F-type ATPase subunit c) (F-ATPase subunit c) (Lipid-binding protein) |
| NCBI Accession ID | CP001047.1 |
| Organism | Mycoplasma arthritidis (strain 158L3-1) |
| Left | 43049 |
| Right | 43321 |
| Strand | + |
| Nucleotide Sequence | ATGGAAACAATCGTAAATGGATTTAACCAACCAAATGCTCAAGCAAGCCCCTTAGCTTATGGACTTACTATGGTTGCGGCAGGCCTTGCCATTATGGGAGCGGGTGTGGTTTCGGTTGGTCAAGGTATGGCTGTTGCTAAAGCCGTTGAAGCAATTGGCCGCAATCCCGAAGCCACCTCTAAGATTCGTTCGACTCTAATTATGGGGCTAGCAATTGTTGAAACAGCTTCAATTTATTGTTTTATTATTGCTTTGTTAATTATCTTTGTTTAG |
| Sequence | METIVNGFNQPNAQASPLAYGLTMVAAGLAIMGAGVVSVGQGMAVAKAVEAIGRNPEATSKIRSTLIMGLAIVETASIYCFIIALLIIFV |
| Source of smORF | Swiss-Prot |
| Function | F(1)F(0) ATP synthase produces ATP from ADP in the presence of a proton or sodium gradient. F-type ATPases consist of two structural domains, F(1) containing the extramembraneous catalytic core and F(0) containing the membrane proton channel, linked together by a central stalk and a peripheral stalk. During catalysis, ATP synthesis in the catalytic domain of F(1) is coupled via a rotary mechanism of the central stalk subunits to proton translocation. {ECO:0000255|HAMAP-Rule:MF_01396}.; Key component of the F(0) channel; it plays a direct role in translocation across the membrane. A homomeric c-ring of between 10-14 subunits forms the central stalk rotor element with the F(1) delta and epsilon subunits. {ECO:0000255|HAMAP-Rule:MF_01396}. |
| Pubmed ID | 18573899 |
| Domain | CDD:412393 |
| Functional Category | Others |
| Uniprot ID | B3PLV3 |
| ORF Length (Amino Acid) | 90 |
++ More..
| Conservation Analysis |
No. of Species: 13
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 42943 | 43215 | + | NZ_LR215047.1 | Mycoplasma arthritidis |
| 2 | 665602 | 665892 | + | NZ_CP030140.1 | Mycoplasma anseris |
| 3 | 304309 | 304605 | - | NZ_CP030103.1 | Mycoplasma cloacale |
| 4 | 21882 | 22187 | + | NZ_CP055143.1 | Mycoplasma hominis |
| 5 | 614892 | 615200 | + | NZ_AP014657.1 | Mycoplasmopsis arginini |
| 6 | 481062 | 481370 | + | NZ_CP033058.2 | Mycoplasma phocicerebrale |
| 7 | 570025 | 570303 | + | NZ_LR214938.2 | Mycoplasma salivarium |
| 8 | 523657 | 523965 | + | NZ_AP014631.1 | Mycoplasma canadense |
| 9 | 125373 | 125669 | + | NZ_CP029295.1 | Mycoplasma phocidae |
| 10 | 263588 | 263875 | + | NZ_CP008748.1 | Mycoplasma hyosynoviae |
| 11 | 433894 | 434184 | - | NZ_CP034044.1 | Mycoplasma struthionis |
| 12 | 286346 | 286651 | + | NZ_LR214950.1 | Mycoplasmopsis gallinacea |
| 13 | 316527 | 316805 | - | NC_002771.1 | Mycoplasmopsis pulmonis UAB CTIP |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LR215047.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00430.20 | 0.85 | 11 | 100 | same-strand | ATP synthase B/B' CF(0) |
| 2 | PF00213.20 | 0.62 | 8 | 604.0 | same-strand | ATP synthase delta (OSCP) subunit |
| 3 | PF02874.25 | 1.0 | 13 | 1112 | same-strand | ATP synthase alpha/beta family, beta-barrel domain |
| 4 | PF00306.29 | 0.92 | 12 | 1858.0 | same-strand | ATP synthase alpha/beta chain, C terminal domain |
++ More..