Protein Information |
Information Type | Description |
---|---|
Protein name | ATP synthase subunit c (ATP synthase F(0) sector subunit c) (F-type ATPase subunit c) (F-ATPase subunit c) (Lipid-binding protein) |
NCBI Accession ID | CP001047.1 |
Organism | Mycoplasma arthritidis (strain 158L3-1) |
Left | 43049 |
Right | 43321 |
Strand | + |
Nucleotide Sequence | ATGGAAACAATCGTAAATGGATTTAACCAACCAAATGCTCAAGCAAGCCCCTTAGCTTATGGACTTACTATGGTTGCGGCAGGCCTTGCCATTATGGGAGCGGGTGTGGTTTCGGTTGGTCAAGGTATGGCTGTTGCTAAAGCCGTTGAAGCAATTGGCCGCAATCCCGAAGCCACCTCTAAGATTCGTTCGACTCTAATTATGGGGCTAGCAATTGTTGAAACAGCTTCAATTTATTGTTTTATTATTGCTTTGTTAATTATCTTTGTTTAG |
Sequence | METIVNGFNQPNAQASPLAYGLTMVAAGLAIMGAGVVSVGQGMAVAKAVEAIGRNPEATSKIRSTLIMGLAIVETASIYCFIIALLIIFV |
Source of smORF | Swiss-Prot |
Function | F(1)F(0) ATP synthase produces ATP from ADP in the presence of a proton or sodium gradient. F-type ATPases consist of two structural domains, F(1) containing the extramembraneous catalytic core and F(0) containing the membrane proton channel, linked together by a central stalk and a peripheral stalk. During catalysis, ATP synthesis in the catalytic domain of F(1) is coupled via a rotary mechanism of the central stalk subunits to proton translocation. {ECO:0000255|HAMAP-Rule:MF_01396}.; Key component of the F(0) channel; it plays a direct role in translocation across the membrane. A homomeric c-ring of between 10-14 subunits forms the central stalk rotor element with the F(1) delta and epsilon subunits. {ECO:0000255|HAMAP-Rule:MF_01396}. |
Pubmed ID | 18573899 |
Domain | CDD:412393 |
Functional Category | Others |
Uniprot ID | B3PLV3 |
ORF Length (Amino Acid) | 90 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 42943 | 43215 | + | NZ_LR215047.1 | Mycoplasma arthritidis |
2 | 665602 | 665892 | + | NZ_CP030140.1 | Mycoplasma anseris |
3 | 304309 | 304605 | - | NZ_CP030103.1 | Mycoplasma cloacale |
4 | 21882 | 22187 | + | NZ_CP055143.1 | Mycoplasma hominis |
5 | 614892 | 615200 | + | NZ_AP014657.1 | Mycoplasmopsis arginini |
6 | 481062 | 481370 | + | NZ_CP033058.2 | Mycoplasma phocicerebrale |
7 | 570025 | 570303 | + | NZ_LR214938.2 | Mycoplasma salivarium |
8 | 523657 | 523965 | + | NZ_AP014631.1 | Mycoplasma canadense |
9 | 125373 | 125669 | + | NZ_CP029295.1 | Mycoplasma phocidae |
10 | 263588 | 263875 | + | NZ_CP008748.1 | Mycoplasma hyosynoviae |
11 | 433894 | 434184 | - | NZ_CP034044.1 | Mycoplasma struthionis |
12 | 286346 | 286651 | + | NZ_LR214950.1 | Mycoplasmopsis gallinacea |
13 | 316527 | 316805 | - | NC_002771.1 | Mycoplasmopsis pulmonis UAB CTIP |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00430.20 | 0.85 | 11 | 100 | same-strand | ATP synthase B/B' CF(0) |
2 | PF00213.20 | 0.62 | 8 | 604.0 | same-strand | ATP synthase delta (OSCP) subunit |
3 | PF02874.25 | 1.0 | 13 | 1112 | same-strand | ATP synthase alpha/beta family, beta-barrel domain |
4 | PF00306.29 | 0.92 | 12 | 1858.0 | same-strand | ATP synthase alpha/beta chain, C terminal domain |