Result : EXP02092
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02092 |
| NCBI Accession ID | NC_016810.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 |
| Left | 1154521 |
| Right | 1154589 |
| Strand | + |
| Nucleotide Sequence | ATGCTCTTATTTTGTTTACATTCTATTACATTTTTGTATTTTAGGCGTGGTGTAAATATTGGGCGGTAG |
| Sequence | MLLFCLHSITFLYFRRGVNIGR |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | Venturini et al 2020 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 22 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1198187 | 1198255 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 3592626 | 3592694 | + | NZ_CP053416.1 | Salmonella bongori |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03328.16 | 1.0 | 2 | 4249.0 | same-strand | HpcH/HpaI aldolase/citrate lyase family |
| 2 | PF07690.18 | 1.0 | 2 | 2787.5 | same-strand | Major Facilitator Superfamily |
| 3 | PF12833.9 | 1.0 | 2 | 1881.5 | same-strand | Helix-turn-helix domain |
| 4 | PF07883.13 | 1.0 | 2 | 1881.5 | same-strand | Cupin domain |
| 5 | PF00165.25 | 1.0 | 2 | 1881.5 | same-strand | Bacterial regulatory helix-turn-helix proteins, AraC family |
| 6 | PF12706.9 | 1.0 | 2 | 929.5 | same-strand | Beta-lactamase superfamily domain |
| 7 | PF13591.8 | 1.0 | 2 | 426.0 | opposite-strand | MerR HTH family regulatory protein |
| 8 | PF01556.20 | 1.0 | 2 | 731.0 | opposite-strand | DnaJ C terminal domain |
| 9 | PF00226.33 | 1.0 | 2 | 731.0 | opposite-strand | DnaJ domain |
| 10 | PF11412.10 | 1.0 | 2 | 2296.5 | same-strand | Disulphide bond corrector protein DsbC |
| 11 | PF13899.8 | 1.0 | 2 | 2296.5 | same-strand | Thioredoxin-like |
| 12 | PF02683.17 | 1.0 | 2 | 2296.5 | same-strand | Cytochrome C biogenesis protein transmembrane region |
| 13 | PF01323.22 | 1.0 | 2 | 4179.5 | same-strand | DSBA-like thioredoxin domain |
| 14 | PF13462.8 | 1.0 | 2 | 4179.5 | same-strand | Thioredoxin |
| 15 | PF13098.8 | 1.0 | 2 | 4179.5 | same-strand | Thioredoxin-like domain |
++ More..