| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02089 |
| NCBI Accession ID | NC_016810.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 |
| Left | 993024 |
| Right | 993116 |
| Strand | + |
| Nucleotide Sequence | GTGTTATGTATGTGCTGCATAATCATGCATGTAAATACCATGTTTACCGGGCTAGTGAAATCTACGCATGGCGTGGACAGACGCCATTCGTGA |
| Sequence | VLCMCCIIMHVNTMFTGLVKSTHGVDRRHS |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | Venturini et al 2020 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 30 |
| Conservation Analysis |
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1036490 | 1036582 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 3470940 | 3471032 | + | NZ_CP053416.1 | Salmonella bongori |
| 3 | 2026683 | 2026775 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 4 | 3901026 | 3901118 | - | NZ_CP045205.1 | Citrobacter telavivensis |
| 5 | 3194937 | 3195029 | + | NZ_LT556085.1 | Citrobacter amalonaticus |
| 6 | 1043174 | 1043266 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 7 | 4442041 | 4442133 | + | NZ_CP033744.1 | Citrobacter freundii |
| 8 | 674299 | 674391 | - | NZ_CP044098.1 | Citrobacter portucalensis |
| 9 | 1596595 | 1596675 | + | NZ_LR134340.1 | Escherichia marmotae |
| 10 | 1779416 | 1779508 | - | NZ_CP038469.1 | Citrobacter tructae |
| 11 | 957966 | 958046 | + | NZ_AP014857.1 | Escherichia albertii |
| 12 | 991956 | 992048 | - | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
| 13 | 1429155 | 1429235 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 14 | 1063431 | 1063511 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 15 | 932353 | 932433 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 16 | 1583878 | 1583961 | + | NZ_CP009756.1 | Enterobacter cloacae |
| 17 | 4101570 | 4101653 | + | NZ_AP019007.1 | Enterobacter oligotrophicus |
| 18 | 1523477 | 1523560 | + | NC_015968.1 | Enterobacter soli |
| 19 | 3517385 | 3517477 | - | NZ_CP041247.1 | Raoultella electrica |
| 20 | 883724 | 883804 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 21 | 465136 | 465219 | + | NZ_CP023529.1 | Lelliottia amnigena |
| Neighborhood Conservation Analysis |
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01176.21 | 1.0 | 20 | 5909 | opposite-strand | Translation initiation factor 1A / IF-1 |
| 2 | PF03588.16 | 1.0 | 20 | 4910 | opposite-strand | Leucyl/phenylalanyl-tRNA protein transferase |
| 3 | PF00005.29 | 1.0 | 20 | 2267.0 | opposite-strand | ABC transporter |
| 4 | PF00664.25 | 1.0 | 20 | 1391.0 | opposite-strand | ABC transporter transmembrane region |
| 5 | PF07992.16 | 1.0 | 20 | 293 | opposite-strand | Pyridine nucleotide-disulphide oxidoreductase |
| 6 | PF00070.29 | 1.0 | 20 | 293 | opposite-strand | Pyridine nucleotide-disulphide oxidoreductase |
| 7 | PF01037.23 | 1.0 | 20 | 163 | same-strand | Lrp/AsnC ligand binding domain |
| 8 | PF13412.8 | 1.0 | 20 | 163 | same-strand | Winged helix-turn-helix DNA-binding |
| 9 | PF13404.8 | 1.0 | 20 | 163 | same-strand | AsnC-type helix-turn-helix domain |
| 10 | PF01580.20 | 1.0 | 20 | 792 | same-strand | FtsK/SpoIIIE family |
| 11 | PF13491.8 | 1.0 | 20 | 792 | same-strand | 4TM region of DNA translocase FtsK/SpoIIIE |
| 12 | PF17854.3 | 1.0 | 20 | 792 | same-strand | FtsK alpha domain |
| 13 | PF09397.12 | 1.0 | 20 | 792 | same-strand | Ftsk gamma domain |
| 14 | PF03548.17 | 1.0 | 20 | 4914 | same-strand | Outer membrane lipoprotein carrier protein LolA |
| 15 | PF12002.10 | 1.0 | 20 | 5534 | same-strand | MgsA AAA+ ATPase C terminal |
| 16 | PF16193.7 | 1.0 | 20 | 5534 | same-strand | AAA C-terminal domain |
| 17 | PF00004.31 | 1.0 | 20 | 5534 | same-strand | ATPase family associated with various cellular activities (AAA) |
| 18 | PF00587.27 | 1.0 | 20 | 6977 | same-strand | tRNA synthetase class II core domain (G, H, P, S and T) |
| 19 | PF02403.24 | 1.0 | 20 | 6977 | same-strand | Seryl-tRNA synthetase N-terminal domain |
| 20 | PF13191.8 | 0.6 | 12 | 3152.0 | opposite-strand | AAA ATPase domain |
| 21 | PF13173.8 | 0.6 | 12 | 5542 | same-strand | AAA domain |