Result : EXP02082
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02082 |
| NCBI Accession ID | NC_016810.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 |
| Left | 687289 |
| Right | 687333 |
| Strand | + |
| Nucleotide Sequence | GTGGTAAATTTTGATTTATTTCACAAAGCGTTAGATGGTTTTTAA |
| Sequence | VVNFDLFHKALDGF |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | Venturini et al 2020 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 14 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 687804 | 687848 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 3177109 | 3177156 | + | NZ_CP053416.1 | Salmonella bongori |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03802.16 | 1.0 | 2 | 3975.0 | opposite-strand | Apo-citrate lyase phosphoribosyl-dephospho-CoA transferase |
| 2 | PF04223.14 | 1.0 | 2 | 2442.0 | opposite-strand | Citrate lyase, alpha subunit (CitF) |
| 3 | PF03328.16 | 1.0 | 2 | 1524.0 | opposite-strand | HpcH/HpaI aldolase/citrate lyase family |
| 4 | PF06857.13 | 1.0 | 2 | 1231.0 | opposite-strand | Malonate decarboxylase delta subunit (MdcD) |
| 5 | PF08218.13 | 1.0 | 2 | 158.0 | opposite-strand | Citrate lyase ligase C-terminal domain |
| 6 | PF02518.28 | 1.0 | 2 | 86.0 | same-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
| 7 | PF14501.8 | 1.0 | 2 | 86.0 | same-strand | GHKL domain |
| 8 | PF00072.26 | 1.0 | 2 | 1812.0 | same-strand | Response regulator receiver domain |
| 9 | PF12431.10 | 1.0 | 2 | 1812.0 | same-strand | Transcriptional regulator |
| 10 | PF03606.17 | 1.0 | 2 | 2542.0 | opposite-strand | C4-dicarboxylate anaerobic carrier |
| 11 | PF07017.13 | 1.0 | 2 | 4311.0 | same-strand | Antimicrobial peptide resistance and lipid A acylation protein PagP |
| 12 | PF00313.24 | 1.0 | 2 | 5071.0 | same-strand | 'Cold-shock' DNA-binding domain |
++ More..