Protein Information |
Information Type | Description |
---|---|
Protein name | EXP02082 |
NCBI Accession ID | NC_016810.1 |
Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 |
Left | 687289 |
Right | 687333 |
Strand | + |
Nucleotide Sequence | GTGGTAAATTTTGATTTATTTCACAAAGCGTTAGATGGTTTTTAA |
Sequence | VVNFDLFHKALDGF |
Source of smORF | Transcriptional-level |
Function | |
Pubmed ID | Venturini et al 2020 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 14 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 687804 | 687848 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
2 | 3177109 | 3177156 | + | NZ_CP053416.1 | Salmonella bongori |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF03802.16 | 1.0 | 2 | 3975.0 | opposite-strand | Apo-citrate lyase phosphoribosyl-dephospho-CoA transferase |
2 | PF04223.14 | 1.0 | 2 | 2442.0 | opposite-strand | Citrate lyase, alpha subunit (CitF) |
3 | PF03328.16 | 1.0 | 2 | 1524.0 | opposite-strand | HpcH/HpaI aldolase/citrate lyase family |
4 | PF06857.13 | 1.0 | 2 | 1231.0 | opposite-strand | Malonate decarboxylase delta subunit (MdcD) |
5 | PF08218.13 | 1.0 | 2 | 158.0 | opposite-strand | Citrate lyase ligase C-terminal domain |
6 | PF02518.28 | 1.0 | 2 | 86.0 | same-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
7 | PF14501.8 | 1.0 | 2 | 86.0 | same-strand | GHKL domain |
8 | PF00072.26 | 1.0 | 2 | 1812.0 | same-strand | Response regulator receiver domain |
9 | PF12431.10 | 1.0 | 2 | 1812.0 | same-strand | Transcriptional regulator |
10 | PF03606.17 | 1.0 | 2 | 2542.0 | opposite-strand | C4-dicarboxylate anaerobic carrier |
11 | PF07017.13 | 1.0 | 2 | 4311.0 | same-strand | Antimicrobial peptide resistance and lipid A acylation protein PagP |
12 | PF00313.24 | 1.0 | 2 | 5071.0 | same-strand | 'Cold-shock' DNA-binding domain |