Result : EXP02079

Protein Information

• Protein name: EXP02079
• NCBI Accession ID: NC_016810.1
• Organism: Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344
• Left: 497833
• Right: 497883
• Strand: +
• Nucleotide Sequence: ATGTTGAGGGATAATTGGTATAACCAATGTAAAAATAAAACAATTACTTAA
• Sequence: MLRDNWYNQCKNKTIT
• Source of smORF: Transcriptional-level
• Pubmed ID: Venturini et al 2020
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 16

Conservation Analysis

No. of Species: 2

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	498348	498398	+	NC_003197.2	Salmonella enterica subsp. enterica serovar Typhimurium str. LT2
2	2530884	2530931	-	NC_009792.1	Citrobacter koseri ATCC BAA-895

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_003197.2

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF01040.20	1.0	2	4107.5	opposite-strand	UbiA prenyltransferase family
2	PF03626.16	1.0	2	3766.5	opposite-strand	Prokaryotic Cytochrome C oxidase subunit IV
3	PF00115.22	1.0	2	1168.5	opposite-strand	Cytochrome C and Quinol oxidase polypeptide I
4	PF06481.16	1.0	2	201.5	opposite-strand	COX Aromatic Rich Motif
5	PF07690.18	1.0	2	206.0	opposite-strand	Major Facilitator Superfamily
6	PF03923.15	1.0	2	1725.5	opposite-strand	Uncharacterized lipoprotein
7	PF01722.20	1.0	2	2611.0	same-strand	BolA-like protein
8	PF05698.16	1.0	2	3272.5	same-strand	Bacterial trigger factor protein (TF) C-terminus
9	PF05697.15	1.0	2	3272.5	same-strand	Bacterial trigger factor protein (TF)
10	PF00254.30	1.0	2	3272.5	same-strand	FKBP-type peptidyl-prolyl cis-trans isomerase
11	PF00574.25	1.0	2	4817.5	same-strand	Clp protease