Result : EXP02066
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02066 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 960241 |
| Right | 960333 |
| Strand | - |
| Nucleotide Sequence | ATGACCCCCGCGCCGGCGACGATGCAGAGCGCAGCGATGAGGAGGAGCGGCGCCATTGACTACCGCCGGCGACGATGCAGAGCGCAGCGATGA |
| Sequence | MTPAPATMQSAAMRRSGAIDYRRRRCRAQR |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 30 |
++ More..
| Conservation Analysis |
No. of Species: 7
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 968038 | 968130 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 960241 | 960333 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 3 | 4018482 | 4018577 | + | NC_022663.1 | Mycobacterium kansasii ATCC 12478 |
| 4 | 4018559 | 4018654 | + | NC_022663.1 | Mycobacterium kansasii ATCC 12478 |
| 5 | 4018636 | 4018731 | + | NC_022663.1 | Mycobacterium kansasii ATCC 12478 |
| 6 | 4018713 | 4018808 | + | NC_022663.1 | Mycobacterium kansasii ATCC 12478 |
| 7 | 5936303 | 5936380 | - | NC_022663.1 | Mycobacterium kansasii ATCC 12478 |
| 8 | 3522647 | 3522721 | - | NZ_CP011883.2 | Mycobacterium haemophilum DSM 44634 |
| 9 | 3825114 | 3825188 | - | NZ_CP011883.2 | Mycobacterium haemophilum DSM 44634 |
| 10 | 2450602 | 2450679 | + | NZ_AP022572.1 | Mycobacterium shottsii |
| 11 | 4148642 | 4148722 | + | NZ_AP022583.1 | Mycobacterium noviomagense |
| 12 | 1376892 | 1376981 | + | NZ_AP022609.1 | Mycolicibacter hiberniae |
++ More..