Result : EXP02063

Protein Information

• Protein name: EXP02063
• NCBI Accession ID: NC_000962.3
• Organism: Mycobacterium tuberculosis H37Rv
• Left: 769590
• Right: 769670
• Strand: -
• Nucleotide Sequence: GTGGGATACGTTTCCCCGGAGCAGCGCGTAGTCAGCGCTCGTGAAATTTGCTGCTGGTGCGGAGGATTAGGCAATGCTTAG
• Sequence: VGYVSPEQRVVSAREICCWCGGLGNA
• Source of smORF: Transcriptional-level
• Pubmed ID: 26536359
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 26

Conservation Analysis

No. of Species: 3

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	779690	779770	-	NC_015848.1	Mycobacterium canettii CIPT 140010059
2	769590	769670	-	NC_000962.3	Mycobacterium tuberculosis H37Rv
3	699584	699661	+	NZ_CP068551.1	Pseudomonas khazarica

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_015848.1

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF00562.30	0.67	2	6264.5	opposite-strand	RNA polymerase Rpb2, domain 6
2	PF10385.11	0.67	2	6264.5	opposite-strand	RNA polymerase beta subunit external 1 domain
3	PF04565.18	0.67	2	6264.5	opposite-strand	RNA polymerase Rpb2, domain 3
4	PF04561.16	0.67	2	6264.5	opposite-strand	RNA polymerase Rpb2, domain 2
5	PF04560.22	0.67	2	6264.5	opposite-strand	RNA polymerase Rpb2, domain 7
6	PF04997.14	0.67	2	2269.5	opposite-strand	RNA polymerase Rpb1, domain 1
7	PF04998.19	0.67	2	2269.5	opposite-strand	RNA polymerase Rpb1, domain 5
8	PF00623.22	0.67	2	2269.5	opposite-strand	RNA polymerase Rpb1, domain 2
9	PF04983.20	0.67	2	2269.5	opposite-strand	RNA polymerase Rpb1, domain 3
10	PF04734.15	0.67	2	-7.0	same-strand	Neutral/alkaline non-lysosomal ceramidase, N-terminal
11	PF17048.7	0.67	2	-7.0	same-strand	Neutral/alkaline non-lysosomal ceramidase, C-terminal
12	PF01261.26	0.67	2	121.5	opposite-strand	Xylose isomerase-like TIM barrel
13	PF18158.3	0.67	2	1813.5	opposite-strand	Adaptive response protein AidB N-terminal domain
14	PF00441.26	0.67	2	1813.5	opposite-strand	Acyl-CoA dehydrogenase, C-terminal domain
15	PF02770.21	0.67	2	1813.5	opposite-strand	Acyl-CoA dehydrogenase, middle domain
16	PF08028.13	0.67	2	1813.5	opposite-strand	Acyl-CoA dehydrogenase, C-terminal domain
17	PF07848.14	0.67	2	4393.5	opposite-strand	PaaX-like protein