Result : EXP02061
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02061 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 701274 |
| Right | 701336 |
| Strand | - |
| Nucleotide Sequence | GTGGCCGAAGCGTTCCATGCGACCGTGCCGTGGCGAGGATCCCGGCCGAACATGGCCCATTGA |
| Sequence | VAEAFHATVPWRGSRPNMAH |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 20 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 701274 | 701336 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 2 | 713798 | 713860 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 3 | 2108037 | 2108093 | + | NZ_AP019700.1 | Stella humosa |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000962.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF02518.28 | 0.67 | 2 | 1557.5 | same-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
| 2 | PF07704.13 | 0.67 | 2 | 1527.0 | opposite-strand | Rv0623-like transcription factor |
| 3 | PF01850.23 | 0.67 | 2 | 1388 | opposite-strand | PIN domain |
++ More..