ProsmORF-pred
Result : EXP02061
Protein Information
Information Type Description
Protein name EXP02061
NCBI Accession ID NC_000962.3
Organism Mycobacterium tuberculosis H37Rv
Left 701274
Right 701336
Strand -
Nucleotide Sequence GTGGCCGAAGCGTTCCATGCGACCGTGCCGTGGCGAGGATCCCGGCCGAACATGGCCCATTGA
Sequence VAEAFHATVPWRGSRPNMAH
Source of smORF Transcriptional-level
Function
Pubmed ID 26536359
Domain
Functional Category Function not yet assigned
Uniprot ID
ORF Length (Amino Acid) 20
++ More..
Conservation Analysis
Conservation Analysis
No. of Species: 3
Sr.No. Left Position Right Position Strand NCBI Accession id Species Name
1 701274 701336 - NC_000962.3 Mycobacterium tuberculosis H37Rv
2 713798 713860 - NC_015848.1 Mycobacterium canettii CIPT 140010059
3 2108037 2108093 + NZ_AP019700.1 Stella humosa
++ More..
Neighborhood Conservation Analysis
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Conservation Analysis
Neighborhood Representative Chosen(Species): NC_000962.3
Sr.No. Domain Co-occurrence Frequency No. of species in which domain occurs with smORF Median distance b/w smORF and domain bearing ORFs Orientation relative to smORF PFAM Information
1 PF02518.28 0.67 2 1557.5 same-strand Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase
2 PF07704.13 0.67 2 1527.0 opposite-strand Rv0623-like transcription factor
3 PF01850.23 0.67 2 1388 opposite-strand PIN domain
++ More..