Result : EXP02059
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02059 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 639911 |
| Right | 639979 |
| Strand | - |
| Nucleotide Sequence | ATGGGTGAACGGATCAGATCGCCGTGGTGGCTCCAGCCGGCGAACAAGGACGGAGTTCAACAGCCTTGA |
| Sequence | MGERIRSPWWLQPANKDGVQQP |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 22 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 653383 | 653451 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 639911 | 639979 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00903.27 | 1.0 | 2 | 1942.0 | same-strand | Glyoxalase/Bleomycin resistance protein/Dioxygenase superfamily |
| 2 | PF12681.9 | 1.0 | 2 | 1942.0 | same-strand | Glyoxalase-like domain |
| 3 | PF18029.3 | 1.0 | 2 | 1942.0 | same-strand | Glyoxalase-like domain |
| 4 | PF00106.27 | 1.0 | 2 | 1020.5 | same-strand | short chain dehydrogenase |
| 5 | PF13561.8 | 1.0 | 2 | 1020.5 | same-strand | Enoyl-(Acyl carrier protein) reductase |
| 6 | PF00378.22 | 1.0 | 2 | -3.0 | same-strand | Enoyl-CoA hydratase/isomerase |
| 7 | PF01850.23 | 1.0 | 2 | 249.0 | same-strand | PIN domain |
| 8 | PF00501.30 | 1.0 | 2 | 1117.0 | same-strand | AMP-binding enzyme |
| 9 | PF13193.8 | 1.0 | 2 | 1117.0 | same-strand | AMP-binding enzyme C-terminal domain |
| 10 | PF07969.13 | 1.0 | 2 | 2910.0 | opposite-strand | Amidohydrolase family |
| 11 | PF01979.22 | 1.0 | 2 | 2910.0 | opposite-strand | Amidohydrolase family |
| 12 | PF13378.8 | 1.0 | 2 | 4511.0 | opposite-strand | Enolase C-terminal domain-like |
| 13 | PF18374.3 | 1.0 | 2 | 4511.0 | opposite-strand | Enolase N-terminal domain-like |
++ More..