Result : EXP02058

Protein Information

• Protein name: EXP02058
• NCBI Accession ID: NC_000962.3
• Organism: Mycobacterium tuberculosis H37Rv
• Left: 612280
• Right: 612417
• Strand: -
• Nucleotide Sequence: GTGACCAGACGACGTCATAGCCGCTGTCCGGCTCGGGAATGTCGTCGAAGCTGCCATGAATCACCCGGATACTGCGGTCGAGTCCGGCCTGACGGTTCTTCTTACGGTTGGTCTCGTTCGGCACTTCGGAGATGTTGA
• Sequence: VTRRRHSRCPARECRRSCHESPGYCGRVRPDGSSYGWSRSALRRC
• Source of smORF: Transcriptional-level
• Pubmed ID: 26536359
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 45

Conservation Analysis

No. of Species: 3

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	625660	625797	-	NC_015848.1	Mycobacterium canettii CIPT 140010059
2	612280	612417	-	NC_000962.3	Mycobacterium tuberculosis H37Rv
3	1174478	1174624	-	NZ_CP004387.1	Alcanivorax pacificus W11-5

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_015848.1

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF01757.24	0.67	2	3519.5	opposite-strand	Acyltransferase family
2	PF13472.8	0.67	2	2692.5	opposite-strand	GDSL-like Lipase/Acylhydrolase family
3	PF00657.24	0.67	2	2692.5	opposite-strand	GDSL-like Lipase/Acylhydrolase
4	PF00756.22	0.67	2	1546.5	same-strand	Putative esterase
5	PF00324.23	0.67	2	621.5	opposite-strand	Amino acid permease
6	PF13520.8	0.67	2	621.5	opposite-strand	Amino acid permease
7	PF00202.23	0.67	2	2418.5	opposite-strand	Aminotransferase class-III
8	PF00300.24	0.67	2	3806.5	opposite-strand	Histidine phosphatase superfamily (branch 1)