Result : EXP02057
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02057 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 592190 |
| Right | 592279 |
| Strand | - |
| Nucleotide Sequence | GTGGTGTCCATCGCCGGGCCGATCATGTTGGCCAGCCGCAGGATAGTCACTGCAATATCGGGGCGGCGTCGGCCCAGCGCGCGCACGTAG |
| Sequence | VVSIAGPIMLASRRIVTAISGRRRPSART |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 29 |
++ More..
| Conservation Analysis |
No. of Species: 38
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 602371 | 602460 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 592190 | 592279 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 3 | 3681633 | 3681722 | + | NZ_AP022590.1 | Mycobacterium mantenii |
| 4 | 4879724 | 4879813 | + | NC_016948.1 | Mycobacterium paraintracellulare |
| 5 | 4751675 | 4751764 | + | NC_016946.1 | Mycobacterium intracellulare ATCC 13950 |
| 6 | 1199568 | 1199654 | - | NZ_AP022618.1 | Mycolicibacterium insubricum |
| 7 | 1562696 | 1562776 | + | NZ_AP022596.1 | Mycolicibacterium helvum |
| 8 | 2325718 | 2325804 | + | NZ_AP022603.1 | Mycolicibacterium fallax |
| 9 | 702054 | 702140 | - | NZ_CP011491.1 | Mycolicibacterium vaccae 95051 |
| 10 | 242566 | 242652 | + | NZ_AP022574.1 | Mycolicibacterium psychrotolerans |
| 11 | 3961715 | 3961801 | - | NZ_AP022567.1 | Mycolicibacterium mageritense |
| 12 | 1058260 | 1058346 | - | NZ_CP020809.1 | Mycobacterium dioxanotrophicus |
| 13 | 5170618 | 5170704 | - | NZ_LR026975.1 | Mycolicibacterium hassiacum DSM 44199 |
| 14 | 2014022 | 2014108 | - | NZ_CP043474.1 | Mycobacterium grossiae |
| 15 | 5015967 | 5016053 | + | NZ_AP022561.1 | Mycolicibacterium aichiense |
| 16 | 4055407 | 4055487 | + | NZ_CP014955.1 | Mycobacteroides abscessus |
| 17 | 3747998 | 3748084 | + | NZ_CP010271.1 | Mycobacteroides saopaulense |
| 18 | 2799743 | 2799829 | + | NZ_AP022593.1 | Mycolicibacterium arabiense |
| 19 | 11261675 | 11261761 | + | NZ_CP012752.1 | Kibdelosporangium phytohabitans |
| 20 | 4297889 | 4297975 | - | NZ_CP023698.1 | Streptomyces viridifaciens |
| 21 | 7011750 | 7011836 | - | NZ_CP015163.1 | Amycolatopsis albispora |
| 22 | 3862239 | 3862334 | + | NZ_CP034687.1 | Streptomyces griseoviridis |
| 23 | 3773927 | 3774013 | + | NC_016109.1 | Kitasatospora setae KM-6054 |
| 24 | 3112079 | 3112165 | + | NZ_CP023202.1 | Streptomyces xinghaiensis S187 |
| 25 | 4511634 | 4511714 | + | NZ_CP045929.1 | Saccharopolyspora coralli |
| 26 | 4347592 | 4347678 | + | NZ_CP023689.1 | Streptomyces chartreusis |
| 27 | 9361847 | 9361933 | + | NZ_CP007155.1 | Kutzneria albida DSM 43870 |
| 28 | 8908539 | 8908619 | + | NC_019673.1 | Saccharothrix espanaensis DSM 44229 |
| 29 | 4006304 | 4006399 | + | NZ_CP049257.1 | Nocardioides anomalus |
| 30 | 8883386 | 8883472 | + | NZ_CP016174.1 | Amycolatopsis orientalis |
| 31 | 4252168 | 4252254 | - | NZ_CP029043.1 | Streptomyces nigra |
| 32 | 5813509 | 5813595 | - | NZ_CP034539.1 | Streptomyces cyaneochromogenes |
| 33 | 5349221 | 5349307 | - | NZ_CP023694.1 | Streptomyces coeruleorubidus |
| 34 | 6968583 | 6968663 | - | NZ_CP031142.1 | Saccharopolyspora pogona |
| 35 | 4971714 | 4971800 | - | NZ_CP021978.1 | Streptomyces hawaiiensis |
| 36 | 6842546 | 6842641 | + | NC_013729.1 | Kribbella flavida DSM 17836 |
| 37 | 297637 | 297732 | - | NC_014165.1 | Thermobispora bispora DSM 43833 |
| 38 | 584004 | 584081 | + | NZ_CP043311.1 | Pseudomonas lalkuanensis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF14748.8 | 0.71 | 27 | 1263 | opposite-strand | Pyrroline-5-carboxylate reductase dimerisation |
| 2 | PF03807.19 | 0.71 | 27 | 1263 | opposite-strand | NADP oxidoreductase coenzyme F420-dependent |
| 3 | PF12728.9 | 0.74 | 28 | 912.0 | opposite-strand | Helix-turn-helix domain |
| 4 | PF08213.13 | 0.68 | 26 | 627.0 | opposite-strand | Mitochondrial domain of unknown function (DUF1713) |
| 5 | PF01553.23 | 0.97 | 37 | 518 | opposite-strand | Acyltransferase |
| 6 | PF12710.9 | 0.87 | 33 | 3133.0 | same-strand | haloacid dehalogenase-like hydrolase |
++ More..