Result : EXP02055
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02055 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 4285826 |
| Right | 4285864 |
| Strand | - |
| Nucleotide Sequence | GTGCCCTGGCGGGGCTCGGTCCGAGTGCAGGAGGAATGA |
| Sequence | VPWRGSVRVQEE |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 12 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4352931 | 4352969 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 4285826 | 4285864 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01553.23 | 1.0 | 2 | 4255.0 | same-strand | Acyltransferase |
| 2 | PF11139.10 | 1.0 | 2 | 25.0 | opposite-strand | Sap, sulfolipid-1-addressing protein |
| 3 | PF08237.13 | 1.0 | 2 | 857.0 | opposite-strand | PE-PPE domain |
| 4 | PF03176.17 | 1.0 | 2 | 2385.5 | same-strand | MMPL family |
| 5 | PF12349.10 | 1.0 | 2 | 2385.5 | same-strand | Sterol-sensing domain of SREBP cleavage-activation |
| 6 | PF00698.23 | 1.0 | 2 | 7351.0 | same-strand | Acyl transferase domain |
| 7 | PF00109.28 | 1.0 | 2 | 7351.0 | same-strand | Beta-ketoacyl synthase, N-terminal domain |
| 8 | PF08659.12 | 1.0 | 2 | 7351.0 | same-strand | KR domain |
| 9 | PF14765.8 | 1.0 | 2 | 7351.0 | same-strand | Polyketide synthase dehydratase |
| 10 | PF02801.24 | 1.0 | 2 | 7351.0 | same-strand | Beta-ketoacyl synthase, C-terminal domain |
| 11 | PF00107.28 | 1.0 | 2 | 7351.0 | same-strand | Zinc-binding dehydrogenase |
| 12 | PF13602.8 | 1.0 | 2 | 7351.0 | same-strand | Zinc-binding dehydrogenase |
| 13 | PF16197.7 | 1.0 | 2 | 7351.0 | same-strand | Ketoacyl-synthetase C-terminal extension |
| 14 | PF00106.27 | 1.0 | 2 | 7351.0 | same-strand | short chain dehydrogenase |
| 15 | PF00550.27 | 1.0 | 2 | 7351.0 | same-strand | Phosphopantetheine attachment site |
++ More..