Protein Information |
Information Type | Description |
---|---|
Protein name | EXP02055 |
NCBI Accession ID | NC_000962.3 |
Organism | Mycobacterium tuberculosis H37Rv |
Left | 4285826 |
Right | 4285864 |
Strand | - |
Nucleotide Sequence | GTGCCCTGGCGGGGCTCGGTCCGAGTGCAGGAGGAATGA |
Sequence | VPWRGSVRVQEE |
Source of smORF | Transcriptional-level |
Function | |
Pubmed ID | 26536359 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 12 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 4352931 | 4352969 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
2 | 4285826 | 4285864 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF01553.23 | 1.0 | 2 | 4255.0 | same-strand | Acyltransferase |
2 | PF11139.10 | 1.0 | 2 | 25.0 | opposite-strand | Sap, sulfolipid-1-addressing protein |
3 | PF08237.13 | 1.0 | 2 | 857.0 | opposite-strand | PE-PPE domain |
4 | PF03176.17 | 1.0 | 2 | 2385.5 | same-strand | MMPL family |
5 | PF12349.10 | 1.0 | 2 | 2385.5 | same-strand | Sterol-sensing domain of SREBP cleavage-activation |
6 | PF00698.23 | 1.0 | 2 | 7351.0 | same-strand | Acyl transferase domain |
7 | PF00109.28 | 1.0 | 2 | 7351.0 | same-strand | Beta-ketoacyl synthase, N-terminal domain |
8 | PF08659.12 | 1.0 | 2 | 7351.0 | same-strand | KR domain |
9 | PF14765.8 | 1.0 | 2 | 7351.0 | same-strand | Polyketide synthase dehydratase |
10 | PF02801.24 | 1.0 | 2 | 7351.0 | same-strand | Beta-ketoacyl synthase, C-terminal domain |
11 | PF00107.28 | 1.0 | 2 | 7351.0 | same-strand | Zinc-binding dehydrogenase |
12 | PF13602.8 | 1.0 | 2 | 7351.0 | same-strand | Zinc-binding dehydrogenase |
13 | PF16197.7 | 1.0 | 2 | 7351.0 | same-strand | Ketoacyl-synthetase C-terminal extension |
14 | PF00106.27 | 1.0 | 2 | 7351.0 | same-strand | short chain dehydrogenase |
15 | PF00550.27 | 1.0 | 2 | 7351.0 | same-strand | Phosphopantetheine attachment site |