ProsmORF-pred
Result : EXP02055
Protein Information
Information Type Description
Protein name EXP02055
NCBI Accession ID NC_000962.3
Organism Mycobacterium tuberculosis H37Rv
Left 4285826
Right 4285864
Strand -
Nucleotide Sequence GTGCCCTGGCGGGGCTCGGTCCGAGTGCAGGAGGAATGA
Sequence VPWRGSVRVQEE
Source of smORF Transcriptional-level
Function
Pubmed ID 26536359
Domain
Functional Category Function not yet assigned
Uniprot ID
ORF Length (Amino Acid) 12
++ More..
Conservation Analysis
Conservation Analysis
No. of Species: 2
Sr.No. Left Position Right Position Strand NCBI Accession id Species Name
1 4352931 4352969 - NC_015848.1 Mycobacterium canettii CIPT 140010059
2 4285826 4285864 - NC_000962.3 Mycobacterium tuberculosis H37Rv
++ More..
Neighborhood Conservation Analysis
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Conservation Analysis
Neighborhood Representative Chosen(Species): NC_015848.1
Sr.No. Domain Co-occurrence Frequency No. of species in which domain occurs with smORF Median distance b/w smORF and domain bearing ORFs Orientation relative to smORF PFAM Information
1 PF01553.23 1.0 2 4255.0 same-strand Acyltransferase
2 PF11139.10 1.0 2 25.0 opposite-strand Sap, sulfolipid-1-addressing protein
3 PF08237.13 1.0 2 857.0 opposite-strand PE-PPE domain
4 PF03176.17 1.0 2 2385.5 same-strand MMPL family
5 PF12349.10 1.0 2 2385.5 same-strand Sterol-sensing domain of SREBP cleavage-activation
6 PF00698.23 1.0 2 7351.0 same-strand Acyl transferase domain
7 PF00109.28 1.0 2 7351.0 same-strand Beta-ketoacyl synthase, N-terminal domain
8 PF08659.12 1.0 2 7351.0 same-strand KR domain
9 PF14765.8 1.0 2 7351.0 same-strand Polyketide synthase dehydratase
10 PF02801.24 1.0 2 7351.0 same-strand Beta-ketoacyl synthase, C-terminal domain
11 PF00107.28 1.0 2 7351.0 same-strand Zinc-binding dehydrogenase
12 PF13602.8 1.0 2 7351.0 same-strand Zinc-binding dehydrogenase
13 PF16197.7 1.0 2 7351.0 same-strand Ketoacyl-synthetase C-terminal extension
14 PF00106.27 1.0 2 7351.0 same-strand short chain dehydrogenase
15 PF00550.27 1.0 2 7351.0 same-strand Phosphopantetheine attachment site
++ More..