Result : EXP02054

Protein Information

• Protein name: EXP02054
• NCBI Accession ID: NC_000962.3
• Organism: Mycobacterium tuberculosis H37Rv
• Left: 4278345
• Right: 4278383
• Strand: -
• Nucleotide Sequence: GTGACCCGGCGCCTTTGTGGCTCGGGAGTGCGTGACTGA
• Sequence: VTRRLCGSGVRD
• Source of smORF: Transcriptional-level
• Pubmed ID: 26536359
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 12

Conservation Analysis

No. of Species: 2

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	4278345	4278383	-	NC_000962.3	Mycobacterium tuberculosis H37Rv
2	4345450	4345488	-	NC_015848.1	Mycobacterium canettii CIPT 140010059

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_000962.3

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF03275.15	1.0	2	4837.5	same-strand	UDP-galactopyranose mutase
2	PF13450.8	1.0	2	4837.5	same-strand	NAD(P)-binding Rossmann-like domain
3	PF01744.22	1.0	2	3717.5	opposite-strand	GLTT repeat (6 copies)
4	PF08310.13	1.0	2	1907.5	opposite-strand	LGFP repeat
5	PF01510.27	1.0	2	1907.5	opposite-strand	N-acetylmuramoyl-L-alanine amidase
6	PF00934.22	1.0	2	239.5	opposite-strand	PE family
7	PF08282.14	1.0	2	11.0	same-strand	haloacid dehalogenase-like hydrolase
8	PF01553.23	1.0	2	1650.0	same-strand	Acyltransferase