Result : EXP02052
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02052 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 4227409 |
| Right | 4227504 |
| Strand | - |
| Nucleotide Sequence | GTGGCCGTGCTGGCCCGACTTGCCGACCCCGGGCGGCAGCGCACCCTGGCGCATTTGTTGCAGCTGCGCGCGCGCCGCCATTTGCTGAGCAAATAG |
| Sequence | VAVLARLADPGRQRTLAHLLQLRARRHLLSK |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 31 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4296037 | 4296132 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 4227409 | 4227504 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 3 | 5422123 | 5422218 | - | NZ_LR130759.1 | Mycobacterium basiliense |
| 4 | 2802388 | 2802474 | + | NZ_AP022568.1 | Mycobacterium simiae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00107.28 | 1.0 | 4 | 3767.5 | opposite-strand | Zinc-binding dehydrogenase |
| 2 | PF13602.8 | 1.0 | 4 | 3767.5 | opposite-strand | Zinc-binding dehydrogenase |
| 3 | PF00266.21 | 1.0 | 4 | 2537.5 | same-strand | Aminotransferase class-V |
| 4 | PF10759.11 | 1.0 | 4 | -95.0 | opposite-strand | Protein of unknown function (DUF2587) |
| 5 | PF00005.29 | 1.0 | 4 | 25.0 | opposite-strand | ABC transporter |
| 6 | PF13641.8 | 1.0 | 4 | 851.5 | opposite-strand | Glycosyltransferase like family 2 |
| 7 | PF01061.26 | 1.0 | 4 | 1770.0 | opposite-strand | ABC-2 type transporter |
++ More..