Result : EXP02047

Protein Information

• Protein name: EXP02047
• NCBI Accession ID: NC_000962.3
• Organism: Mycobacterium tuberculosis H37Rv
• Left: 39829
• Right: 39867
• Strand: -
• Nucleotide Sequence: ATGCCTTTCCCGACGAACTGTTACCTCAGGAGGTGGTGA
• Sequence: MPFPTNCYLRRW
• Source of smORF: Transcriptional-level
• Pubmed ID: 26536359
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 12

Conservation Analysis

No. of Species: 2

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	39875	39913	-	NC_015848.1	Mycobacterium canettii CIPT 140010059
2	39829	39867	-	NC_000962.3	Mycobacterium tuberculosis H37Rv

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_015848.1

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF00155.23	1.0	2	3275.5	opposite-strand	Aminotransferase class I and II
2	PF13480.9	1.0	2	3275.5	opposite-strand	Acetyltransferase (GNAT) domain
3	PF00550.27	1.0	2	3015.5	opposite-strand	Phosphopantetheine attachment site
4	PF12680.9	1.0	2	2623.5	opposite-strand	SnoaL-like domain
5	PF00501.30	1.0	2	938.5	opposite-strand	AMP-binding enzyme
6	PF11716.10	1.0	2	0.0	same-strand	Mycothiol maleylpyruvate isomerase N-terminal domain
7	PF08608.14	1.0	2	0.0	same-strand	Wyosine base formation
8	PF07690.18	1.0	2	10.0	same-strand	Major Facilitator Superfamily
9	PF02622.17	1.0	2	1413.0	opposite-strand	Uncharacterized ACR, COG1678
10	PF10738.11	1.0	2	2566.0	same-strand	Probable lipoprotein LpqN
11	PF13603.8	1.0	2	3728.0	opposite-strand	Leucyl-tRNA synthetase, Domain 2
12	PF08264.15	1.0	2	3728.0	opposite-strand	Anticodon-binding domain of tRNA ligase