Result : EXP02043
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02043 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 3824581 |
| Right | 3824634 |
| Strand | - |
| Nucleotide Sequence | GTGTTGGGGGCTCCGCTGATGGGCGCTGGGCAGGCTGGCGGGGGCGAGTCGTGA |
| Sequence | VLGAPLMGAGQAGGGES |
| Source of smORF | Transcriptional-level |
| Function | It is a short ORF coupled to a downstream gene whose start codon overlaps the stop codon of this ORF. This indicates that this smORF might be translationally coupled to downstream gene. Pubmed:26536359 |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Manually curated function from literature |
| Uniprot ID | |
| ORF Length (Amino Acid) | 17 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3891838 | 3891891 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 3824581 | 3824634 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03632.17 | 1.0 | 2 | 4150.0 | opposite-strand | Glycosyl hydrolase family 65 central catalytic domain |
| 2 | PF03636.17 | 1.0 | 2 | 4150.0 | opposite-strand | Glycosyl hydrolase family 65, N-terminal domain |
| 3 | PF03633.17 | 1.0 | 2 | 4150.0 | opposite-strand | Glycosyl hydrolase family 65, C-terminal domain |
| 4 | PF01041.19 | 1.0 | 2 | 2689.5 | same-strand | DegT/DnrJ/EryC1/StrS aminotransferase family |
| 5 | PF13454.8 | 1.0 | 2 | 718.0 | same-strand | FAD-NAD(P)-binding |
| 6 | PF18216.3 | 1.0 | 2 | -3.0 | same-strand | N-formyltransferase dimerization C-terminal domain |
| 7 | PF00440.25 | 1.0 | 2 | 68.0 | same-strand | Bacterial regulatory proteins, tetR family |
| 8 | PF02668.18 | 1.0 | 2 | 696.0 | opposite-strand | Taurine catabolism dioxygenase TauD, TfdA family |
| 9 | PF01850.23 | 1.0 | 2 | 1923.0 | opposite-strand | PIN domain |
++ More..