Result : EXP02042
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02042 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 3692412 |
| Right | 3692492 |
| Strand | - |
| Nucleotide Sequence | ATGATGCGCACACCGCGATCCTGCTGGGTGCCGCATTGGCATTGGCTTCGGTACCGGAGCTGCCGGTGGGGGTGCGGTTGA |
| Sequence | MMRTPRSCWVPHWHWLRYRSCRWGCG |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 26 |
++ More..
| Conservation Analysis |
No. of Species: 13
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3692412 | 3692492 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 2 | 3753585 | 3753665 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 3 | 4567225 | 4567305 | + | NC_022663.1 | Mycobacterium kansasii ATCC 12478 |
| 4 | 3268720 | 3268800 | - | NZ_AP022590.1 | Mycobacterium mantenii |
| 5 | 955002 | 955082 | + | NZ_CP011883.2 | Mycobacterium haemophilum DSM 44634 |
| 6 | 2782521 | 2782601 | - | NZ_AP022575.1 | Mycobacterium shinjukuense |
| 7 | 1008050 | 1008136 | + | NC_014158.1 | Tsukamurella paurometabola DSM 20162 |
| 8 | 1470304 | 1470381 | + | NZ_CP025546.1 | Mycobacterium paragordonae |
| 9 | 5773475 | 5773552 | + | NZ_AP022601.1 | Mycobacterium gallinarum |
| 10 | 1919942 | 1920019 | + | NZ_AP022570.1 | Mycolicibacterium poriferae |
| 11 | 5398909 | 5398989 | + | NZ_AP022582.1 | Mycobacterium seoulense |
| 12 | 115863 | 115940 | - | NZ_CP015235.1 | Rhodococcus fascians D188 |
| 13 | 42027 | 42110 | - | NZ_CP039289.1 | Cupriavidus necator H16 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000962.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01266.26 | 0.62 | 8 | 3877.0 | same-strand | FAD dependent oxidoreductase |
| 2 | PF07992.16 | 0.77 | 10 | 2379.5 | same-strand | Pyridine nucleotide-disulphide oxidoreductase |
| 3 | PF02852.24 | 0.77 | 10 | 2379.5 | same-strand | Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain |
| 4 | PF00070.29 | 0.77 | 10 | 2379.5 | same-strand | Pyridine nucleotide-disulphide oxidoreductase |
| 5 | PF13772.8 | 0.85 | 11 | 1828 | opposite-strand | AIG2-like family |
| 6 | PF06094.14 | 0.69 | 9 | 1942 | opposite-strand | Gamma-glutamyl cyclotransferase, AIG2-like |
| 7 | PF01546.30 | 0.92 | 12 | -80.0 | same-strand | Peptidase family M20/M25/M40 |
| 8 | PF07687.16 | 0.85 | 11 | 313 | same-strand | Peptidase dimerisation domain |
| 9 | PF01048.22 | 0.92 | 12 | 1593.0 | opposite-strand | Phosphorylase superfamily |
| 10 | PF02878.18 | 0.77 | 10 | 2766.5 | opposite-strand | Phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain I |
| 11 | PF02880.18 | 0.69 | 9 | 2498 | opposite-strand | Phosphoglucomutase/phosphomannomutase, alpha/beta/alpha domain III |
++ More..