Result : EXP02041
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02041 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 3687550 |
| Right | 3687630 |
| Strand | - |
| Nucleotide Sequence | GTGGATCCGCGGCAGCACCACACGACGACTCAGGGTCAGAGAGGCGTGACACCATGCGGACGGTCTATCACCAGCGGCTAA |
| Sequence | VDPRQHHTTTQGQRGVTPCGRSITSG |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 26 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3748607 | 3748687 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 3687550 | 3687630 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 3 | 4151234 | 4151311 | - | NZ_CP022437.1 | Virgibacillus necropolis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01149.26 | 0.67 | 2 | 5463.0 | opposite-strand | Formamidopyrimidine-DNA glycosylase N-terminal domain |
| 2 | PF00884.25 | 0.67 | 2 | 1590.0 | same-strand | Sulfatase |
| 3 | PF06897.14 | 0.67 | 2 | 1590.0 | same-strand | Protein of unknown function (DUF1269) |
| 4 | PF00849.24 | 0.67 | 2 | 650.0 | same-strand | RNA pseudouridylate synthase |
| 5 | PF01895.21 | 0.67 | 2 | -27.0 | same-strand | PhoU domain |
| 6 | PF01266.26 | 0.67 | 2 | 55.0 | same-strand | FAD dependent oxidoreductase |
| 7 | PF16901.7 | 0.67 | 2 | 55.0 | same-strand | C-terminal domain of alpha-glycerophosphate oxidase |
| 8 | PF07992.16 | 0.67 | 2 | 1860.0 | same-strand | Pyridine nucleotide-disulphide oxidoreductase |
| 9 | PF02852.24 | 0.67 | 2 | 1860.0 | same-strand | Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain |
| 10 | PF00070.29 | 0.67 | 2 | 1860.0 | same-strand | Pyridine nucleotide-disulphide oxidoreductase |
| 11 | PF13772.8 | 0.67 | 2 | 3509.0 | opposite-strand | AIG2-like family |
| 12 | PF06094.14 | 0.67 | 2 | 3509.0 | opposite-strand | Gamma-glutamyl cyclotransferase, AIG2-like |
| 13 | PF01546.30 | 0.67 | 2 | 4067.0 | same-strand | Peptidase family M20/M25/M40 |
| 14 | PF07687.16 | 0.67 | 2 | 5233.0 | same-strand | Peptidase dimerisation domain |
++ More..