Result : EXP02040
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02040 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 3685960 |
| Right | 3686013 |
| Strand | - |
| Nucleotide Sequence | ATGGTCAGCCGCGGCCGATTGCCGGCCGTGACACACATATCGGGAGTTTCGTGA |
| Sequence | MVSRGRLPAVTHISGVS |
| Source of smORF | Transcriptional-level |
| Function | It is a short ORF coupled to a downstream gene whose start codon overlaps the stop codon of this ORF. This indicates that this smORF might be translationally coupled to downstream gene. Pubmed:26536359 |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Manually curated function from literature |
| Uniprot ID | |
| ORF Length (Amino Acid) | 17 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3747017 | 3747070 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 3685960 | 3686013 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00440.25 | 1.0 | 2 | 9229.0 | opposite-strand | Bacterial regulatory proteins, tetR family |
| 2 | PF08494.13 | 1.0 | 2 | 4644.0 | opposite-strand | DEAD/H associated |
| 3 | PF00270.31 | 1.0 | 2 | 4644.0 | opposite-strand | DEAD/DEAH box helicase |
| 4 | PF04851.17 | 1.0 | 2 | 4644.0 | opposite-strand | Type III restriction enzyme, res subunit |
| 5 | PF01149.26 | 1.0 | 2 | 3873.0 | opposite-strand | Formamidopyrimidine-DNA glycosylase N-terminal domain |
| 6 | PF00884.25 | 1.0 | 2 | 0.0 | same-strand | Sulfatase |
| 7 | PF06897.14 | 1.0 | 2 | 0.0 | same-strand | Protein of unknown function (DUF1269) |
| 8 | PF00849.24 | 1.0 | 2 | -30.0 | same-strand | RNA pseudouridylate synthase |
| 9 | PF01895.21 | 1.0 | 2 | 899.0 | same-strand | PhoU domain |
| 10 | PF01266.26 | 1.0 | 2 | 1672.0 | same-strand | FAD dependent oxidoreductase |
| 11 | PF16901.7 | 1.0 | 2 | 1672.0 | same-strand | C-terminal domain of alpha-glycerophosphate oxidase |
| 12 | PF07992.16 | 1.0 | 2 | 3477.0 | same-strand | Pyridine nucleotide-disulphide oxidoreductase |
| 13 | PF02852.24 | 1.0 | 2 | 3477.0 | same-strand | Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain |
| 14 | PF00070.29 | 1.0 | 2 | 3477.0 | same-strand | Pyridine nucleotide-disulphide oxidoreductase |
| 15 | PF13772.8 | 1.0 | 2 | 5126.0 | opposite-strand | AIG2-like family |
| 16 | PF06094.14 | 1.0 | 2 | 5126.0 | opposite-strand | Gamma-glutamyl cyclotransferase, AIG2-like |
++ More..