Protein Information |
Information Type | Description |
---|---|
Protein name | EXP02040 |
NCBI Accession ID | NC_000962.3 |
Organism | Mycobacterium tuberculosis H37Rv |
Left | 3685960 |
Right | 3686013 |
Strand | - |
Nucleotide Sequence | ATGGTCAGCCGCGGCCGATTGCCGGCCGTGACACACATATCGGGAGTTTCGTGA |
Sequence | MVSRGRLPAVTHISGVS |
Source of smORF | Transcriptional-level |
Function | It is a short ORF coupled to a downstream gene whose start codon overlaps the stop codon of this ORF. This indicates that this smORF might be translationally coupled to downstream gene. Pubmed:26536359 |
Pubmed ID | 26536359 |
Domain | |
Functional Category | Manually curated function from literature |
Uniprot ID | |
ORF Length (Amino Acid) | 17 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 3747017 | 3747070 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
2 | 3685960 | 3686013 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00440.25 | 1.0 | 2 | 9229.0 | opposite-strand | Bacterial regulatory proteins, tetR family |
2 | PF08494.13 | 1.0 | 2 | 4644.0 | opposite-strand | DEAD/H associated |
3 | PF00270.31 | 1.0 | 2 | 4644.0 | opposite-strand | DEAD/DEAH box helicase |
4 | PF04851.17 | 1.0 | 2 | 4644.0 | opposite-strand | Type III restriction enzyme, res subunit |
5 | PF01149.26 | 1.0 | 2 | 3873.0 | opposite-strand | Formamidopyrimidine-DNA glycosylase N-terminal domain |
6 | PF00884.25 | 1.0 | 2 | 0.0 | same-strand | Sulfatase |
7 | PF06897.14 | 1.0 | 2 | 0.0 | same-strand | Protein of unknown function (DUF1269) |
8 | PF00849.24 | 1.0 | 2 | -30.0 | same-strand | RNA pseudouridylate synthase |
9 | PF01895.21 | 1.0 | 2 | 899.0 | same-strand | PhoU domain |
10 | PF01266.26 | 1.0 | 2 | 1672.0 | same-strand | FAD dependent oxidoreductase |
11 | PF16901.7 | 1.0 | 2 | 1672.0 | same-strand | C-terminal domain of alpha-glycerophosphate oxidase |
12 | PF07992.16 | 1.0 | 2 | 3477.0 | same-strand | Pyridine nucleotide-disulphide oxidoreductase |
13 | PF02852.24 | 1.0 | 2 | 3477.0 | same-strand | Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain |
14 | PF00070.29 | 1.0 | 2 | 3477.0 | same-strand | Pyridine nucleotide-disulphide oxidoreductase |
15 | PF13772.8 | 1.0 | 2 | 5126.0 | opposite-strand | AIG2-like family |
16 | PF06094.14 | 1.0 | 2 | 5126.0 | opposite-strand | Gamma-glutamyl cyclotransferase, AIG2-like |