Protein Information |
Information Type | Description |
---|---|
Protein name | EXP02039 |
NCBI Accession ID | NC_000962.3 |
Organism | Mycobacterium tuberculosis H37Rv |
Left | 3660075 |
Right | 3660143 |
Strand | - |
Nucleotide Sequence | GTGTCGATGATGAATGTGGTGCCGCCGACGATGGCAAATTTGATCAGCTCATGGTGGCGCTGCGCATAG |
Sequence | VSMMNVVPPTMANLISSWWRCA |
Source of smORF | Transcriptional-level |
Function | |
Pubmed ID | 26536359 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 22 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 3720589 | 3720657 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
2 | 3660075 | 3660143 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
3 | 4619795 | 4619854 | + | NC_022663.1 | Mycobacterium kansasii ATCC 12478 |
4 | 983225 | 983284 | + | NZ_CP011883.2 | Mycobacterium haemophilum DSM 44634 |
5 | 1473098 | 1473157 | - | NZ_AP022568.1 | Mycobacterium simiae |
6 | 1513236 | 1513295 | + | NZ_CP025546.1 | Mycobacterium paragordonae |
7 | 3103281 | 3103340 | - | NZ_AP022614.1 | Mycobacterium parmense |
8 | 3218063 | 3218125 | - | NZ_AP022590.1 | Mycobacterium mantenii |
9 | 4462669 | 4462731 | - | NC_016948.1 | Mycobacterium paraintracellulare |
10 | 4328343 | 4328405 | - | NC_016946.1 | Mycobacterium intracellulare ATCC 13950 |
11 | 4216894 | 4216956 | - | NZ_CP023147.1 | Mycobacterium marseillense |
12 | 4171438 | 4171500 | - | NZ_CP009360.4 | Mycobacterium avium subsp. hominissuis |
13 | 5032897 | 5032959 | + | NZ_AP022573.1 | Mycobacterium saskatchewanense |
14 | 1453961 | 1454023 | + | NZ_LR134356.1 | Mycolicibacterium aurum |
15 | 2962267 | 2962329 | - | NZ_AP022563.1 | Mycolicibacterium duvalii |
16 | 1106003 | 1106059 | + | NC_006361.1 | Nocardia farcinica IFM 10152 |
17 | 5950893 | 5950955 | - | NZ_AP022598.1 | Mycolicibacterium parafortuitum |
18 | 335573 | 335635 | - | NZ_AP022606.1 | Mycobacterium branderi |
19 | 1816437 | 1816499 | + | NC_008726.1 | Mycolicibacterium vanbaalenii PYR-1 |
20 | 1503025 | 1503099 | + | NZ_CP011491.1 | Mycolicibacterium vaccae 95051 |
21 | 5123186 | 5123248 | - | NZ_AP022574.1 | Mycolicibacterium psychrotolerans |
22 | 2256337 | 2256399 | + | NZ_AP023172.1 | Rhodococcus qingshengii |
23 | 4206531 | 4206590 | + | NZ_LS483468.1 | Rhodococcus coprophilus |
24 | 4075447 | 4075524 | - | NZ_CP045929.1 | Saccharopolyspora coralli |
25 | 1342673 | 1342735 | - | NZ_CP015137.1 | Dickeya solani IPO 2222 |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00441.26 | 0.6 | 15 | 2005 | same-strand | Acyl-CoA dehydrogenase, C-terminal domain |
2 | PF02770.21 | 0.6 | 15 | 2005 | same-strand | Acyl-CoA dehydrogenase, middle domain |
3 | PF02771.18 | 0.6 | 15 | 2005 | same-strand | Acyl-CoA dehydrogenase, N-terminal domain |
4 | PF08028.13 | 0.6 | 15 | 2005 | same-strand | Acyl-CoA dehydrogenase, C-terminal domain |
5 | PF00731.22 | 0.92 | 23 | 1425 | same-strand | AIR carboxylase |
6 | PF02222.24 | 0.96 | 24 | 176.0 | same-strand | ATP-grasp domain |
7 | PF17769.3 | 0.96 | 24 | 176.0 | same-strand | Phosphoribosylaminoimidazole carboxylase C-terminal domain |
8 | PF04138.16 | 0.96 | 24 | -62.0 | opposite-strand | GtrA-like protein |
9 | PF03703.16 | 0.8 | 20 | 518.5 | same-strand | Bacterial PH domain |
10 | PF02237.19 | 0.6 | 15 | 1063 | same-strand | Biotin protein ligase C terminal domain |