Result : EXP02038
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02038 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 3595556 |
| Right | 3595609 |
| Strand | - |
| Nucleotide Sequence | ATGCAACCTTTTGATCGTTTCACAGGCTCAACAGATGTCAATAGTGTTACGTAA |
| Sequence | MQPFDRFTGSTDVNSVT |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 17 |
++ More..
| Conservation Analysis |
No. of Species: 10
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1397362 | 1397415 | + | NZ_LR130759.1 | Mycobacterium basiliense |
| 2 | 1614339 | 1614392 | + | NZ_CP025546.1 | Mycobacterium paragordonae |
| 3 | 4727775 | 4727828 | + | NC_022663.1 | Mycobacterium kansasii ATCC 12478 |
| 4 | 3650287 | 3650340 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 5 | 3595556 | 3595609 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 6 | 2251222 | 2251275 | - | NZ_AP022576.1 | Mycobacterium florentinum |
| 7 | 2553589 | 2553642 | - | NZ_AP022587.1 | Mycobacterium stomatepiae |
| 8 | 3048770 | 3048823 | + | NZ_CP058277.1 | Mycobacterium marinum |
| 9 | 1658428 | 1658481 | + | NZ_AP018410.1 | Mycobacterium pseudoshottsii JCM 15466 |
| 10 | 5761396 | 5761449 | - | NZ_AP022572.1 | Mycobacterium shottsii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LR130759.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF04542.16 | 0.8 | 8 | 2789.0 | same-strand | Sigma-70 region 2 |
| 2 | PF08281.14 | 0.8 | 8 | 2789.0 | same-strand | Sigma-70, region 4 |
| 3 | PF04545.18 | 0.8 | 8 | 2789.0 | same-strand | Sigma-70, region 4 |
| 4 | PF13490.8 | 1.0 | 10 | 2475.5 | same-strand | Putative zinc-finger |
| 5 | PF00364.24 | 1.0 | 10 | 1968.0 | same-strand | Biotin-requiring enzyme |
| 6 | PF12282.10 | 1.0 | 10 | 421.0 | same-strand | Signal transduction histidine kinase |
| 7 | PF07568.14 | 1.0 | 10 | 421.0 | same-strand | Histidine kinase |
| 8 | PF02518.28 | 1.0 | 10 | 421.0 | same-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
| 9 | PF07536.16 | 1.0 | 10 | 421.0 | same-strand | HWE histidine kinase |
| 10 | PF08448.12 | 0.8 | 8 | 422.5 | same-strand | PAS fold |
| 11 | PF02467.18 | 1.0 | 10 | 106.5 | opposite-strand | Transcription factor WhiB |
| 12 | PF00781.26 | 1.0 | 10 | 124.0 | opposite-strand | Diacylglycerol kinase catalytic domain |
| 13 | PF13508.9 | 0.8 | 8 | 1597.0 | opposite-strand | Acetyltransferase (GNAT) domain |
| 14 | PF00425.20 | 1.0 | 10 | 2129.5 | opposite-strand | chorismate binding enzyme |
| 15 | PF00300.24 | 0.9 | 9 | 3173 | opposite-strand | Histidine phosphatase superfamily (branch 1) |
++ More..