Result : EXP02037
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02037 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 3591489 |
| Right | 3591569 |
| Strand | - |
| Nucleotide Sequence | GTGACTGCGCGGGCGACGACGAAGGGAGAGCACGATGAGGTGGGGGTCCCTGCCGCTTGCGGGGGAGAGCGGCGCCTATGA |
| Sequence | VTARATTKGEHDEVGVPAACGGERRL |
| Source of smORF | Transcriptional-level |
| Function | It is a short ORF coupled to a downstream gene whose start codon overlaps the stop codon of this ORF. This indicates that this smORF might be translationally coupled to downstream gene. Pubmed:26536359 |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Manually curated function from literature |
| Uniprot ID | |
| ORF Length (Amino Acid) | 26 |
++ More..
| Conservation Analysis |
No. of Species: 9
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3646224 | 3646304 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 279609 | 279689 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 3 | 3219206 | 3219271 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 4 | 3591489 | 3591569 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 5 | 3160518 | 3160583 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 6 | 272851 | 272931 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 7 | 2992607 | 2992687 | - | NZ_AP022587.1 | Mycobacterium stomatepiae |
| 8 | 3078678 | 3078758 | + | NZ_AP022587.1 | Mycobacterium stomatepiae |
| 9 | 571853 | 571933 | + | NZ_AP022575.1 | Mycobacterium shinjukuense |
| 10 | 1987020 | 1987100 | + | NZ_AP022575.1 | Mycobacterium shinjukuense |
| 11 | 4871893 | 4871973 | + | NZ_AP022581.1 | Mycobacterium lacus |
| 12 | 2780400 | 2780480 | - | NZ_AP022581.1 | Mycobacterium lacus |
| 13 | 1722785 | 1722865 | + | NZ_AP022581.1 | Mycobacterium lacus |
| 14 | 576030 | 576113 | - | NZ_AP022581.1 | Mycobacterium lacus |
| 15 | 4640302 | 4640388 | - | NZ_CP025546.1 | Mycobacterium paragordonae |
| 16 | 4018463 | 4018540 | + | NC_022663.1 | Mycobacterium kansasii ATCC 12478 |
| 17 | 3445218 | 3445295 | + | NZ_AP022568.1 | Mycobacterium simiae |
| 18 | 2579920 | 2580003 | - | NZ_AP022609.1 | Mycolicibacter hiberniae |
++ More..