Result : EXP02035
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02035 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 3363093 |
| Right | 3363152 |
| Strand | - |
| Nucleotide Sequence | ATGGACAAGGCCGGAAAGCCCGGGATGCTCGTAGTAATTGGTCGGCGCGTTGGTGCCTGA |
| Sequence | MDKAGKPGMLVVIGRRVGA |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 19 |
++ More..
| Conservation Analysis |
No. of Species: 23
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3422926 | 3422985 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 3363093 | 3363152 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 3 | 1705860 | 1705919 | + | NZ_LR130759.1 | Mycobacterium basiliense |
| 4 | 5617649 | 5617708 | + | NZ_AP022573.1 | Mycobacterium saskatchewanense |
| 5 | 5750276 | 5750335 | + | NZ_AP022619.1 | Mycobacterium paraseoulense |
| 6 | 909989 | 910048 | - | NZ_AP022568.1 | Mycobacterium simiae |
| 7 | 386527 | 386586 | + | NZ_AP022582.1 | Mycobacterium seoulense |
| 8 | 1620059 | 1620118 | + | NZ_AP018164.1 | Mycobacterium shigaense |
| 9 | 1846572 | 1846631 | - | NZ_AP022576.1 | Mycobacterium florentinum |
| 10 | 1922696 | 1922755 | - | NZ_AP022587.1 | Mycobacterium stomatepiae |
| 11 | 94154 | 94213 | + | NZ_AP022590.1 | Mycobacterium mantenii |
| 12 | 2602463 | 2602522 | - | NZ_AP022614.1 | Mycobacterium parmense |
| 13 | 1386876 | 1386935 | + | NZ_CP011883.2 | Mycobacterium haemophilum DSM 44634 |
| 14 | 529855 | 529914 | - | NZ_AP022615.1 | Mycobacterium heidelbergense |
| 15 | 1996564 | 1996623 | - | NZ_CP029543.1 | Mycobacterium leprae |
| 16 | 4027263 | 4027319 | - | NC_016948.1 | Mycobacterium paraintracellulare |
| 17 | 3909737 | 3909793 | - | NC_016946.1 | Mycobacterium intracellulare ATCC 13950 |
| 18 | 3757076 | 3757132 | - | NZ_CP023147.1 | Mycobacterium marseillense |
| 19 | 3666640 | 3666696 | - | NZ_CP009360.4 | Mycobacterium avium subsp. hominissuis |
| 20 | 3408055 | 3408114 | + | NZ_CP058277.1 | Mycobacterium marinum |
| 21 | 4528032 | 4528091 | - | NZ_AP018410.1 | Mycobacterium pseudoshottsii JCM 15466 |
| 22 | 3289928 | 3289987 | + | NZ_AP022583.1 | Mycobacterium noviomagense |
| 23 | 5371810 | 5371869 | - | NZ_AP022572.1 | Mycobacterium shottsii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LR130759.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF07991.14 | 1.0 | 23 | 2526 | same-strand | Acetohydroxy acid isomeroreductase, NADPH-binding domain |
| 2 | PF01450.21 | 1.0 | 23 | 2526 | same-strand | Acetohydroxy acid isomeroreductase, catalytic domain |
| 3 | PF10369.11 | 1.0 | 23 | 1989 | same-strand | Small subunit of acetolactate synthase |
| 4 | PF13710.8 | 1.0 | 23 | 1989 | same-strand | ACT domain |
| 5 | PF01842.27 | 1.0 | 23 | 1990 | same-strand | ACT domain |
| 6 | PF13291.8 | 1.0 | 23 | 1989 | same-strand | ACT domain |
| 7 | PF02776.20 | 1.0 | 23 | 123 | same-strand | Thiamine pyrophosphate enzyme, N-terminal TPP binding domain |
| 8 | PF00205.24 | 1.0 | 23 | 123 | same-strand | Thiamine pyrophosphate enzyme, central domain |
| 9 | PF02775.23 | 1.0 | 23 | 123 | same-strand | Thiamine pyrophosphate enzyme, C-terminal TPP binding domain |
| 10 | PF10756.11 | 0.96 | 22 | 156.5 | opposite-strand | Bacterial PH domain |
| 11 | PF07681.14 | 1.0 | 23 | 538 | same-strand | DoxX |
| 12 | PF02934.17 | 0.83 | 19 | 2835 | same-strand | GatB/GatE catalytic domain |
| 13 | PF02637.20 | 0.83 | 19 | 2835 | same-strand | GatB domain |
| 14 | PF03358.17 | 0.78 | 18 | 3629.5 | opposite-strand | NADPH-dependent FMN reductase |
++ More..