Result : EXP02033
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02033 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 3332732 |
| Right | 3332782 |
| Strand | - |
| Nucleotide Sequence | GTGACCGTCTGTACGCGAAAGGGATGCAGTGACCGCACGGCCGTTGAGTGA |
| Sequence | VTVCTRKGCSDRTAVE |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 16 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3392225 | 3392275 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 3332732 | 3332782 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00271.33 | 1.0 | 2 | 2785.0 | same-strand | Helicase conserved C-terminal domain |
| 2 | PF00270.31 | 1.0 | 2 | 2785.0 | same-strand | DEAD/DEAH box helicase |
| 3 | PF04851.17 | 1.0 | 2 | 2785.0 | same-strand | Type III restriction enzyme, res subunit |
| 4 | PF13684.8 | 1.0 | 2 | 1245.5 | same-strand | Dihydroxyacetone kinase family |
| 5 | PF00830.21 | 1.0 | 2 | 684.0 | opposite-strand | Ribosomal L28 family |
| 6 | PF03167.21 | 1.0 | 2 | -22.0 | same-strand | Uracil DNA glycosylase superfamily |
| 7 | PF00586.26 | 1.0 | 2 | 5.0 | same-strand | AIR synthase related protein, N-terminal domain |
| 8 | PF01385.21 | 1.0 | 2 | 1003.0 | same-strand | Probable transposase |
| 9 | PF07282.13 | 1.0 | 2 | 1003.0 | same-strand | Putative transposase DNA-binding domain |
| 10 | PF00239.23 | 1.0 | 2 | 2382.0 | same-strand | Resolvase, N terminal domain |
| 11 | PF12028.10 | 1.0 | 2 | 3148.0 | opposite-strand | Protein of unknown function (DUF3515) |
| 12 | PF07478.15 | 1.0 | 2 | 4071.5 | same-strand | D-ala D-ala ligase C-terminus |
| 13 | PF01820.23 | 1.0 | 2 | 4071.5 | same-strand | D-ala D-ala ligase N-terminus |
| 14 | PF02222.24 | 1.0 | 2 | 4071.5 | same-strand | ATP-grasp domain |
++ More..