Protein Information |
Information Type | Description |
---|---|
Protein name | EXP02033 |
NCBI Accession ID | NC_000962.3 |
Organism | Mycobacterium tuberculosis H37Rv |
Left | 3332732 |
Right | 3332782 |
Strand | - |
Nucleotide Sequence | GTGACCGTCTGTACGCGAAAGGGATGCAGTGACCGCACGGCCGTTGAGTGA |
Sequence | VTVCTRKGCSDRTAVE |
Source of smORF | Transcriptional-level |
Function | |
Pubmed ID | 26536359 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 16 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 3392225 | 3392275 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
2 | 3332732 | 3332782 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00271.33 | 1.0 | 2 | 2785.0 | same-strand | Helicase conserved C-terminal domain |
2 | PF00270.31 | 1.0 | 2 | 2785.0 | same-strand | DEAD/DEAH box helicase |
3 | PF04851.17 | 1.0 | 2 | 2785.0 | same-strand | Type III restriction enzyme, res subunit |
4 | PF13684.8 | 1.0 | 2 | 1245.5 | same-strand | Dihydroxyacetone kinase family |
5 | PF00830.21 | 1.0 | 2 | 684.0 | opposite-strand | Ribosomal L28 family |
6 | PF03167.21 | 1.0 | 2 | -22.0 | same-strand | Uracil DNA glycosylase superfamily |
7 | PF00586.26 | 1.0 | 2 | 5.0 | same-strand | AIR synthase related protein, N-terminal domain |
8 | PF01385.21 | 1.0 | 2 | 1003.0 | same-strand | Probable transposase |
9 | PF07282.13 | 1.0 | 2 | 1003.0 | same-strand | Putative transposase DNA-binding domain |
10 | PF00239.23 | 1.0 | 2 | 2382.0 | same-strand | Resolvase, N terminal domain |
11 | PF12028.10 | 1.0 | 2 | 3148.0 | opposite-strand | Protein of unknown function (DUF3515) |
12 | PF07478.15 | 1.0 | 2 | 4071.5 | same-strand | D-ala D-ala ligase C-terminus |
13 | PF01820.23 | 1.0 | 2 | 4071.5 | same-strand | D-ala D-ala ligase N-terminus |
14 | PF02222.24 | 1.0 | 2 | 4071.5 | same-strand | ATP-grasp domain |