Result : EXP02032
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02032 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 3318812 |
| Right | 3318889 |
| Strand | - |
| Nucleotide Sequence | ATGACCGCCGGCGACGATGCGGTGGGGGCCGTGCCCGCTTGCGGGGGACGCAGCGATGAGGAGGAGCGGCGCAGATGA |
| Sequence | MTAGDDAVGAVPACGGRSDEEERRR |
| Source of smORF | Transcriptional-level |
| Function | It is a short ORF coupled to a downstream gene whose start codon overlaps the stop codon of this ORF. This indicates that this smORF might be translationally coupled to downstream gene. Pubmed:26536359 |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Manually curated function from literature |
| Uniprot ID | |
| ORF Length (Amino Acid) | 25 |
++ More..
| Conservation Analysis |
No. of Species: 14
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3378307 | 3378384 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 2099571 | 2099651 | + | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 3 | 3318812 | 3318889 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 4 | 2059441 | 2059521 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 5 | 2059518 | 2059598 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 6 | 3073055 | 3073135 | + | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 7 | 3550474 | 3550548 | - | NZ_AP022619.1 | Mycobacterium paraseoulense |
| 8 | 5756181 | 5756261 | + | NZ_AP022619.1 | Mycobacterium paraseoulense |
| 9 | 3533642 | 3533725 | - | NZ_AP022619.1 | Mycobacterium paraseoulense |
| 10 | 3712739 | 3712813 | - | NZ_AP022582.1 | Mycobacterium seoulense |
| 11 | 3121047 | 3121127 | + | NZ_AP022615.1 | Mycobacterium heidelbergense |
| 12 | 3087102 | 3087188 | + | NZ_AP022615.1 | Mycobacterium heidelbergense |
| 13 | 5980070 | 5980150 | - | NZ_AP022590.1 | Mycobacterium mantenii |
| 14 | 1393951 | 1394031 | + | NZ_CP011883.2 | Mycobacterium haemophilum DSM 44634 |
| 15 | 4022606 | 4022671 | + | NZ_CP011883.2 | Mycobacterium haemophilum DSM 44634 |
| 16 | 4403034 | 4403114 | + | NZ_AP022614.1 | Mycobacterium parmense |
| 17 | 868812 | 868877 | + | NZ_AP022575.1 | Mycobacterium shinjukuense |
| 18 | 4238517 | 4238594 | + | NZ_AP022575.1 | Mycobacterium shinjukuense |
| 19 | 777446 | 777523 | + | NZ_AP022575.1 | Mycobacterium shinjukuense |
| 20 | 2027811 | 2027873 | - | NZ_AP022575.1 | Mycobacterium shinjukuense |
| 21 | 2197625 | 2197705 | - | NZ_AP022575.1 | Mycobacterium shinjukuense |
| 22 | 3422989 | 3423069 | + | NZ_AP022581.1 | Mycobacterium lacus |
| 23 | 4215187 | 4215267 | + | NZ_AP022581.1 | Mycobacterium lacus |
| 24 | 3598709 | 3598789 | - | NZ_AP022581.1 | Mycobacterium lacus |
| 25 | 1588883 | 1588966 | - | NZ_AP022581.1 | Mycobacterium lacus |
| 26 | 5055112 | 5055180 | + | NZ_AP022581.1 | Mycobacterium lacus |
| 27 | 1266108 | 1266197 | - | NZ_AP022569.1 | Mycobacterium cookii |
| 28 | 2592329 | 2592394 | - | NZ_AP022606.1 | Mycobacterium branderi |
| 29 | 2383760 | 2383834 | - | NZ_LT906469.1 | Mycolicibacter terrae |
| 30 | 1804361 | 1804429 | + | NZ_LT593929.1 | Propionibacterium freudenreichii |
++ More..