Result : EXP02031
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02031 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 3309905 |
| Right | 3309973 |
| Strand | - |
| Nucleotide Sequence | ATGGCAGATGTTGCGCTTGAACAACAGACGGTCGAGGTCGAAGGCGCCACCCCAGCGGAAATTGGTTGA |
| Sequence | MADVALEQQTVEVEGATPAEIG |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 22 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3366526 | 3366594 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 3309905 | 3309973 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 3 | 5246763 | 5246831 | + | NC_022663.1 | Mycobacterium kansasii ATCC 12478 |
| 4 | 3167876 | 3167944 | - | NZ_AP022606.1 | Mycobacterium branderi |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03435.20 | 0.75 | 3 | 3370 | opposite-strand | Saccharopine dehydrogenase NADP binding domain |
| 2 | PF13649.8 | 0.75 | 3 | 2514 | same-strand | Methyltransferase domain |
| 3 | PF08241.14 | 0.75 | 3 | 2514 | same-strand | Methyltransferase domain |
| 4 | PF08242.14 | 0.75 | 3 | 2514 | same-strand | Methyltransferase domain |
| 5 | PF05050.14 | 0.75 | 3 | 506 | opposite-strand | Methyltransferase FkbM domain |
++ More..