Result : EXP02028
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02028 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 3027644 |
| Right | 3027700 |
| Strand | - |
| Nucleotide Sequence | GTGCACGGTGAACCCGACGACCTCATGACCGTGCTGGGCCATCCGGTATTCCAGTAG |
| Sequence | VHGEPDDLMTVLGHPVFQ |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 18 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3086875 | 3086931 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 3027644 | 3027700 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 3 | 3868451 | 3868507 | + | NZ_CP026746.1 | Nocardia cyriacigeorgica |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF04539.18 | 0.67 | 2 | 4212.0 | opposite-strand | Sigma-70 region 3 |
| 2 | PF04542.16 | 0.67 | 2 | 4212.0 | opposite-strand | Sigma-70 region 2 |
| 3 | PF04545.18 | 0.67 | 2 | 4212.0 | opposite-strand | Sigma-70, region 4 |
| 4 | PF00140.22 | 0.67 | 2 | 4212.0 | opposite-strand | Sigma-70 factor, region 1.2 |
| 5 | PF02742.17 | 1.0 | 3 | 3387 | opposite-strand | Iron dependent repressor, metal binding and dimerisation domain |
| 6 | PF01325.21 | 1.0 | 3 | 3387 | opposite-strand | Iron dependent repressor, N-terminal DNA binding domain |
| 7 | PF18357.3 | 1.0 | 3 | 3387 | opposite-strand | Diphteria toxin repressor SH3 domain |
| 8 | PF04023.16 | 1.0 | 3 | 3387 | opposite-strand | FeoA domain |
| 9 | PF13463.8 | 0.67 | 2 | 3387.0 | opposite-strand | Winged helix DNA-binding domain |
| 10 | PF13830.8 | 1.0 | 3 | 2292 | same-strand | Domain of unknown function (DUF4192) |
| 11 | PF07992.16 | 0.67 | 2 | 797.0 | opposite-strand | Pyridine nucleotide-disulphide oxidoreductase |
| 12 | PF02852.24 | 0.67 | 2 | 797.0 | opposite-strand | Pyridine nucleotide-disulphide oxidoreductase, dimerisation domain |
| 13 | PF00070.29 | 0.67 | 2 | 797.0 | opposite-strand | Pyridine nucleotide-disulphide oxidoreductase |
| 14 | PF09754.11 | 1.0 | 3 | -56 | opposite-strand | PAC2 family |
| 15 | PF12697.9 | 0.67 | 2 | 398.0 | opposite-strand | Alpha/beta hydrolase family |
| 16 | PF12146.10 | 0.67 | 2 | 398.0 | opposite-strand | Serine aminopeptidase, S33 |
| 17 | PF08768.13 | 0.67 | 2 | 2167.0 | same-strand | THAP4-like, heme-binding beta-barrel domain |
| 18 | PF03477.18 | 0.67 | 2 | 2713.0 | same-strand | ATP cone domain |
| 19 | PF01476.22 | 0.67 | 2 | 3340.0 | same-strand | LysM domain |
++ More..