Result : EXP02027
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02027 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 3015156 |
| Right | 3015212 |
| Strand | - |
| Nucleotide Sequence | GTGCGACCACACGTGCACTTTAATCCGCTGACGACGCGTGCCGGCACGGCGCGGTGA |
| Sequence | VRPHVHFNPLTTRAGTAR |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 18 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3074387 | 3074443 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 3015156 | 3015212 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 3 | 2272764 | 2272820 | - | NZ_AP022575.1 | Mycobacterium shinjukuense |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF12502.10 | 1.0 | 3 | 1548 | same-strand | Protein of unknown function (DUF3710) |
| 2 | PF00692.21 | 1.0 | 3 | 1009 | same-strand | dUTPase |
| 3 | PF11292.10 | 1.0 | 3 | 498 | opposite-strand | Protein of unknown function (DUF3093) |
| 4 | PF13834.8 | 1.0 | 3 | 191 | same-strand | Domain of unknown function (DUF4193) |
| 5 | PF13399.8 | 1.0 | 3 | 228 | opposite-strand | LytR cell envelope-related transcriptional attenuator |
| 6 | PF00459.27 | 1.0 | 3 | 651 | same-strand | Inositol monophosphatase family |
| 7 | PF04539.18 | 1.0 | 3 | 2623 | opposite-strand | Sigma-70 region 3 |
| 8 | PF04542.16 | 1.0 | 3 | 2623 | opposite-strand | Sigma-70 region 2 |
| 9 | PF04545.18 | 1.0 | 3 | 2623 | opposite-strand | Sigma-70, region 4 |
| 10 | PF00140.22 | 1.0 | 3 | 2623 | opposite-strand | Sigma-70 factor, region 1.2 |
| 11 | PF01042.23 | 0.67 | 2 | 4246.0 | opposite-strand | Endoribonuclease L-PSP |
++ More..