Result : EXP02024
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02024 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 2705955 |
| Right | 2706029 |
| Strand | - |
| Nucleotide Sequence | GTGCGATCAGCACAAGCCGGCTATCGGTGTGGCGCCATGGAAATGCTTTGCACGGCGAATAGTTTCCCTCGCTGA |
| Sequence | VRSAQAGYRCGAMEMLCTANSFPR |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 24 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2766477 | 2766551 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 2705955 | 2706029 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF14032.8 | 1.0 | 2 | 4675.5 | same-strand | PknH-like extracellular domain |
| 2 | PF00009.29 | 1.0 | 2 | 2713.0 | same-strand | Elongation factor Tu GTP binding domain |
| 3 | PF06421.14 | 1.0 | 2 | 2713.0 | same-strand | GTP-binding protein LepA C-terminus |
| 4 | PF00679.26 | 1.0 | 2 | 2713.0 | same-strand | Elongation factor G C-terminus |
| 5 | PF03144.27 | 1.0 | 2 | 2713.0 | same-strand | Elongation factor Tu domain 2 |
| 6 | PF01926.25 | 1.0 | 2 | 2713.0 | same-strand | 50S ribosome-binding GTPase |
| 7 | PF02452.19 | 1.0 | 2 | 2127.5 | opposite-strand | PemK-like, MazF-like toxin of type II toxin-antitoxin system |
| 8 | PF00571.30 | 1.0 | 2 | 1528.5 | same-strand | CBS domain |
| 9 | PF12706.9 | 1.0 | 2 | 437.0 | opposite-strand | Beta-lactamase superfamily domain |
| 10 | PF01841.21 | 1.0 | 2 | 465.0 | same-strand | Transglutaminase-like superfamily |
| 11 | PF08379.12 | 1.0 | 2 | 465.0 | same-strand | Bacterial transglutaminase-like N-terminal region |
| 12 | PF04168.14 | 1.0 | 2 | 1304.0 | same-strand | A predicted alpha-helical domain with a conserved ER motif. |
| 13 | PF04174.15 | 1.0 | 2 | 2281.0 | same-strand | A circularly permuted ATPgrasp |
| 14 | PF14403.8 | 1.0 | 2 | 2281.0 | same-strand | Circularly permuted ATP-grasp type 2 |
| 15 | PF01649.20 | 1.0 | 2 | 4044.5 | opposite-strand | Ribosomal protein S20 |
| 16 | PF06144.15 | 1.0 | 2 | 4320.5 | same-strand | DNA polymerase III, delta subunit |
++ More..