Result : EXP02023
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02023 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 2697827 |
| Right | 2697910 |
| Strand | - |
| Nucleotide Sequence | GTGCACGCAGCATCGGGTTTTTCGGGGCGCTATGTCGGCGCGCTCGTTTGCGGCGCTGCGGCCAACCTGCACTGTTGTCGCTGA |
| Sequence | VHAASGFSGRYVGALVCGAAANLHCCR |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 27 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2756871 | 2756954 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 2697827 | 2697910 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00934.22 | 1.0 | 2 | 3943.0 | opposite-strand | PE family |
| 2 | PF00005.29 | 1.0 | 2 | 2863.0 | same-strand | ABC transporter |
| 3 | PF12857.9 | 1.0 | 2 | 2863.0 | same-strand | TOBE-like domain |
| 4 | PF08402.12 | 1.0 | 2 | 2863.0 | same-strand | TOBE domain |
| 5 | PF13401.8 | 1.0 | 2 | 2863.0 | same-strand | AAA domain |
| 6 | PF00528.24 | 1.0 | 2 | 1604.0 | same-strand | Binding-protein-dependent transport system inner membrane component |
| 7 | PF13531.8 | 1.0 | 2 | 113.0 | same-strand | Bacterial extracellular solute-binding protein |
| 8 | PF13416.8 | 1.0 | 2 | 113.0 | same-strand | Bacterial extracellular solute-binding protein |
| 9 | PF14032.8 | 1.0 | 2 | 3353.5 | same-strand | PknH-like extracellular domain |
| 10 | PF00009.29 | 1.0 | 2 | 4105.5 | same-strand | Elongation factor Tu GTP binding domain |
| 11 | PF06421.14 | 1.0 | 2 | 4105.5 | same-strand | GTP-binding protein LepA C-terminus |
| 12 | PF00679.26 | 1.0 | 2 | 4105.5 | same-strand | Elongation factor G C-terminus |
| 13 | PF03144.27 | 1.0 | 2 | 4105.5 | same-strand | Elongation factor Tu domain 2 |
| 14 | PF01926.25 | 1.0 | 2 | 4105.5 | same-strand | 50S ribosome-binding GTPase |
++ More..