ProsmORF-pred
Result : EXP02021
Protein Information
Information Type Description
Protein name EXP02021
NCBI Accession ID NC_000962.3
Organism Mycobacterium tuberculosis H37Rv
Left 2584922
Right 2584966
Strand -
Nucleotide Sequence GTGTCGTTTCGGGCGGGTAAGGCTCGATTCGAGGGCGCCGGCTGA
Sequence VSFRAGKARFEGAG
Source of smORF Transcriptional-level
Function
Pubmed ID 26536359
Domain
Functional Category Function not yet assigned
Uniprot ID
ORF Length (Amino Acid) 14
++ More..
Conservation Analysis
Conservation Analysis
No. of Species: 2
Sr.No. Left Position Right Position Strand NCBI Accession id Species Name
1 2642029 2642073 - NC_015848.1 Mycobacterium canettii CIPT 140010059
2 2584922 2584966 - NC_000962.3 Mycobacterium tuberculosis H37Rv
++ More..
Neighborhood Conservation Analysis
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Conservation Analysis
Neighborhood Representative Chosen(Species): NC_015848.1
Sr.No. Domain Co-occurrence Frequency No. of species in which domain occurs with smORF Median distance b/w smORF and domain bearing ORFs Orientation relative to smORF PFAM Information
1 PF12728.9 1.0 2 1142.5 opposite-strand Helix-turn-helix domain
2 PF19289.1 1.0 2 1636.0 same-strand PmbA/TldA metallopeptidase C-terminal domain
3 PF00528.24 1.0 2 4301.5 opposite-strand Binding-protein-dependent transport system inner membrane component
++ More..