ProsmORF-pred
Result : EXP02020
Protein Information
Information Type Description
Protein name EXP02020
NCBI Accession ID NC_000962.3
Organism Mycobacterium tuberculosis H37Rv
Left 2576657
Right 2576731
Strand -
Nucleotide Sequence GTGATCCCGGCGACGATGGCGGTCGCCTTCTCGAGATCGGTCACCTCGTCGACCCGCAGCACGATCGCCAGGTAG
Sequence VIPATMAVAFSRSVTSSTRSTIAR
Source of smORF Transcriptional-level
Function
Pubmed ID 26536359
Domain
Functional Category Function not yet assigned
Uniprot ID
ORF Length (Amino Acid) 24
++ More..
Conservation Analysis
Conservation Analysis
No. of Species: 2
Sr.No. Left Position Right Position Strand NCBI Accession id Species Name
1 2633763 2633837 - NC_015848.1 Mycobacterium canettii CIPT 140010059
2 2576657 2576731 - NC_000962.3 Mycobacterium tuberculosis H37Rv
++ More..
Neighborhood Conservation Analysis
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Conservation Analysis
Neighborhood Representative Chosen(Species): NC_015848.1
Sr.No. Domain Co-occurrence Frequency No. of species in which domain occurs with smORF Median distance b/w smORF and domain bearing ORFs Orientation relative to smORF PFAM Information
1 PF01083.24 1.0 2 2950.5 opposite-strand Cutinase
2 PF08940.13 1.0 2 2602.5 opposite-strand Domain of unknown function (DUF1918)
3 PF04909.16 1.0 2 1638.0 same-strand Amidohydrolase
4 PF04255.16 1.0 2 3689.0 opposite-strand Protein of unknown function (DUF433)
++ More..