Result : EXP02019

Protein Information

• Protein name: EXP02019
• NCBI Accession ID: NC_000962.3
• Organism: Mycobacterium tuberculosis H37Rv
• Left: 2551390
• Right: 2551449
• Strand: -
• Nucleotide Sequence: GTGCGCCGCGCATTGCGCACGTTTCTACGGTGGGGAAAGCCTGAAGGGGACCGATGGTGA
• Sequence: VRRALRTFLRWGKPEGDRW
• Source of smORF: Transcriptional-level
• Pubmed ID: 26536359
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 19

Conservation Analysis

No. of Species: 2

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	2605857	2605916	-	NC_015848.1	Mycobacterium canettii CIPT 140010059
2	2551390	2551449	-	NC_000962.3	Mycobacterium tuberculosis H37Rv

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_015848.1

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF16715.7	1.0	2	2959.5	opposite-strand	Cyclodipeptide synthase
2	PF03009.19	1.0	2	677.5	same-strand	Glycerophosphoryl diester phosphodiesterase family
3	PF02913.21	1.0	2	111.0	opposite-strand	FAD linked oxidases, C-terminal domain
4	PF01565.25	1.0	2	111.0	opposite-strand	FAD binding domain
5	PF01384.22	1.0	2	1724.0	opposite-strand	Phosphate transporter family
6	PF03466.22	1.0	2	3489.0	same-strand	LysR substrate binding domain
7	PF07859.15	1.0	2	4696.0	opposite-strand	alpha/beta hydrolase fold
8	PF00326.23	1.0	2	4696.0	opposite-strand	Prolyl oligopeptidase family