Result : EXP02017
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02017 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 2487413 |
| Right | 2487478 |
| Strand | - |
| Nucleotide Sequence | ATGGTCGGCAAGATCGTAACCGGTGGCATGCCGAACGGGAACCTGGTTATCGGGTCTGCCCGATGA |
| Sequence | MVGKIVTGGMPNGNLVIGSAR |
| Source of smORF | Transcriptional-level |
| Function | It is a short ORF coupled to a downstream gene whose start codon overlaps the stop codon of this ORF. This indicates that this smORF might be translationally coupled to downstream gene. Pubmed:26536359 |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Manually curated function from literature |
| Uniprot ID | |
| ORF Length (Amino Acid) | 21 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2540255 | 2540320 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 2487413 | 2487478 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF08338.13 | 1.0 | 2 | 2882.0 | opposite-strand | Domain of unknown function (DUF1731) |
| 2 | PF01370.23 | 1.0 | 2 | 2882.0 | opposite-strand | NAD dependent epimerase/dehydratase family |
| 3 | PF04055.23 | 1.0 | 2 | 1205.0 | opposite-strand | Radical SAM superfamily |
| 4 | PF13829.8 | 1.0 | 2 | 426.0 | opposite-strand | Domain of unknown function (DUF4191) |
| 5 | PF00120.26 | 1.0 | 2 | 2530.5 | both-strands | Glutamine synthetase, catalytic domain |
| 6 | PF03951.21 | 1.0 | 2 | 2530.5 | both-strands | Glutamine synthetase, beta-Grasp domain |
| 7 | PF03710.17 | 1.0 | 2 | 1891.0 | same-strand | Glutamate-ammonia ligase adenylyltransferase |
| 8 | PF08335.13 | 1.0 | 2 | 1891.0 | same-strand | GlnD PII-uridylyltransferase |
| 9 | PF00561.22 | 1.0 | 2 | 7171.0 | same-strand | alpha/beta hydrolase fold |
| 10 | PF08386.12 | 1.0 | 2 | 7983 | same-strand | TAP-like protein |
++ More..