Result : EXP02015
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02015 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 2453371 |
| Right | 2453448 |
| Strand | - |
| Nucleotide Sequence | GTGTCGATGCCCCTGGAGCCCTATAGCAGAAGTACGATCGTCCACAGCGAAATGGTAGAAATCTATCCATTTTCTTAA |
| Sequence | VSMPLEPYSRSTIVHSEMVEIYPFS |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 25 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2506039 | 2506116 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 2453371 | 2453448 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00501.30 | 1.0 | 2 | 3409.0 | opposite-strand | AMP-binding enzyme |
| 2 | PF00534.22 | 1.0 | 2 | 2221.0 | same-strand | Glycosyl transferases group 1 |
| 3 | PF13692.8 | 1.0 | 2 | 2221.0 | same-strand | Glycosyl transferases group 1 |
| 4 | PF13439.8 | 1.0 | 2 | 2221.0 | same-strand | Glycosyltransferase Family 4 |
| 5 | PF13524.8 | 1.0 | 2 | 2221.0 | same-strand | Glycosyl transferases group 1 |
| 6 | PF00877.21 | 1.0 | 2 | 75.0 | same-strand | NlpC/P60 family |
| 7 | PF00929.26 | 1.0 | 2 | 365.0 | opposite-strand | Exonuclease |
| 8 | PF16473.7 | 1.0 | 2 | 365.0 | opposite-strand | 3' exoribonuclease, RNase T-like |
| 9 | PF00591.23 | 1.0 | 2 | 2183.0 | same-strand | Glycosyl transferase family, a/b domain |
| 10 | PF02885.19 | 1.0 | 2 | 2183.0 | same-strand | Glycosyl transferase family, helical bundle domain |
| 11 | PF13442.8 | 1.0 | 2 | 4105.0 | opposite-strand | Cytochrome C oxidase, cbb3-type, subunit III |
| 12 | PF00034.23 | 1.0 | 2 | 4105.0 | opposite-strand | Cytochrome c |
++ More..