Result : EXP02013
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02013 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 2307139 |
| Right | 2307195 |
| Strand | - |
| Nucleotide Sequence | ATGGACGGCAGGCTTTGCACGGGCGCACTGGTGCCCAGGGAGTATTGGACGCTTTGA |
| Sequence | MDGRLCTGALVPREYWTL |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 18 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2356922 | 2356978 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 2307139 | 2307195 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF10861.10 | 1.0 | 2 | 17511.0 | same-strand | Protein of Unknown function (DUF2784) |
| 2 | PF00135.30 | 1.0 | 2 | 15953.0 | same-strand | Carboxylesterase family |
| 3 | PF00391.25 | 1.0 | 2 | 12617.5 | same-strand | PEP-utilising enzyme, mobile domain |
| 4 | PF00109.28 | 1.0 | 2 | 153.0 | same-strand | Beta-ketoacyl synthase, N-terminal domain |
| 5 | PF00698.23 | 1.0 | 2 | 153.0 | same-strand | Acyl transferase domain |
| 6 | PF08659.12 | 1.0 | 2 | 153.0 | same-strand | KR domain |
| 7 | PF14765.8 | 1.0 | 2 | 153.0 | same-strand | Polyketide synthase dehydratase |
| 8 | PF02801.24 | 1.0 | 2 | 153.0 | same-strand | Beta-ketoacyl synthase, C-terminal domain |
| 9 | PF13602.8 | 1.0 | 2 | 153.0 | same-strand | Zinc-binding dehydrogenase |
| 10 | PF16197.7 | 1.0 | 2 | 153.0 | same-strand | Ketoacyl-synthetase C-terminal extension |
| 11 | PF00550.27 | 1.0 | 2 | 153.0 | same-strand | Phosphopantetheine attachment site |
| 12 | PF00106.27 | 1.0 | 2 | 153.0 | same-strand | short chain dehydrogenase |
| 13 | PF13397.8 | 1.0 | 2 | 626.0 | opposite-strand | RNA polymerase-binding protein |
| 14 | PF20154.1 | 1.0 | 2 | 936.0 | same-strand | Apolipoprotein N-acyltransferase N-terminal domain |
| 15 | PF00535.28 | 1.0 | 2 | 936.0 | same-strand | Glycosyl transferase family 2 |
| 16 | PF00795.24 | 1.0 | 2 | 936.0 | same-strand | Carbon-nitrogen hydrolase |
| 17 | PF13641.8 | 1.0 | 2 | 936.0 | same-strand | Glycosyltransferase like family 2 |
| 18 | PF07969.13 | 1.0 | 2 | 3691.0 | same-strand | Amidohydrolase family |
| 19 | PF04186.15 | 1.0 | 2 | 5300.0 | same-strand | FxsA cytoplasmic membrane protein |
++ More..