Result : EXP02012
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02012 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 2271745 |
| Right | 2271825 |
| Strand | - |
| Nucleotide Sequence | ATGAATGCAGATAAAAGAGCTTGCTTGGTGGTCGAACGCGGCCGATCTGGCCTGCTGTCACAAAGGGCCTGCGCCCGATGA |
| Sequence | MNADKRACLVVERGRSGLLSQRACAR |
| Source of smORF | Transcriptional-level |
| Function | It is a short ORF coupled to a downstream gene whose start codon overlaps the stop codon of this ORF. This indicates that this smORF might be translationally coupled to downstream gene. Pubmed:26536359 |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Manually curated function from literature |
| Uniprot ID | |
| ORF Length (Amino Acid) | 26 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2271745 | 2271825 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
| 2 | 2321527 | 2321607 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 3 | 2904536 | 2904610 | - | NZ_CP041025.1 | Paremcibacter congregatus |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000962.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01381.24 | 0.67 | 2 | 4500.5 | same-strand | Helix-turn-helix |
| 2 | PF13560.8 | 0.67 | 2 | 4500.5 | same-strand | Helix-turn-helix domain |
| 3 | PF12844.9 | 0.67 | 2 | 4500.5 | same-strand | Helix-turn-helix domain |
| 4 | PF05973.16 | 0.67 | 2 | 3979.5 | same-strand | Phage derived protein Gp49-like (DUF891) |
| 5 | PF01545.23 | 0.67 | 2 | 36.0 | same-strand | Cation efflux family |
| 6 | PF16916.7 | 0.67 | 2 | 36.0 | same-strand | Dimerisation domain of Zinc Transporter |
| 7 | PF00582.28 | 0.67 | 2 | 1391.0 | same-strand | Universal stress protein family |
| 8 | PF13185.8 | 0.67 | 2 | 962.0 | same-strand | GAF domain |
| 9 | PF01590.28 | 0.67 | 2 | 962.0 | same-strand | GAF domain |
| 10 | PF13492.8 | 0.67 | 2 | 962.0 | same-strand | GAF domain |
| 11 | PF07730.15 | 0.67 | 2 | 962.0 | same-strand | Histidine kinase |
| 12 | PF00294.26 | 0.67 | 2 | 3580.0 | same-strand | pfkB family carbohydrate kinase |
| 13 | PF05139.16 | 0.67 | 2 | 4616.0 | same-strand | Erythromycin esterase |
| 14 | PF00156.29 | 0.67 | 2 | 4616.0 | same-strand | Phosphoribosyl transferase domain |
++ More..