Protein Information |
Information Type | Description |
---|---|
Protein name | EXP02010 |
NCBI Accession ID | NC_000962.3 |
Organism | Mycobacterium tuberculosis H37Rv |
Left | 2074703 |
Right | 2074750 |
Strand | - |
Nucleotide Sequence | GTGATCAAAGTATCGCGGTCGCCGGGCGCATTAGGCACTAACCGCTAG |
Sequence | VIKVSRSPGALGTNR |
Source of smORF | Transcriptional-level |
Function | |
Pubmed ID | 26536359 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 15 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 2113144 | 2113191 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
2 | 2074703 | 2074750 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF05949.14 | 1.0 | 2 | 2817.0 | opposite-strand | Bacterial protein of unknown function (DUF881) |
2 | PF01597.21 | 1.0 | 2 | 2375.0 | opposite-strand | Glycine cleavage H-protein |
3 | PF00498.28 | 1.0 | 2 | 1647.0 | opposite-strand | FHA domain |
4 | PF16697.7 | 1.0 | 2 | 1647.0 | opposite-strand | Inner membrane component of T3SS, cytoplasmic domain |
5 | PF00376.25 | 1.0 | 2 | 907.0 | opposite-strand | MerR family regulatory protein |
6 | PF13411.8 | 1.0 | 2 | 507.5 | opposite-strand | MerR HTH family regulatory protein |
7 | PF02577.16 | 1.0 | 2 | 294.0 | opposite-strand | Domain of unknown function (DUF151) |
8 | PF02347.18 | 1.0 | 2 | 1127.0 | opposite-strand | Glycine cleavage system P-protein |
9 | PF12697.9 | 1.0 | 2 | 4677.5 | both-strands | Alpha/beta hydrolase family |
10 | PF12146.10 | 1.0 | 2 | 4677.5 | both-strands | Serine aminopeptidase, S33 |
11 | PF00561.22 | 1.0 | 2 | 5179.0 | opposite-strand | alpha/beta hydrolase fold |