Result : EXP02010
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP02010 |
| NCBI Accession ID | NC_000962.3 |
| Organism | Mycobacterium tuberculosis H37Rv |
| Left | 2074703 |
| Right | 2074750 |
| Strand | - |
| Nucleotide Sequence | GTGATCAAAGTATCGCGGTCGCCGGGCGCATTAGGCACTAACCGCTAG |
| Sequence | VIKVSRSPGALGTNR |
| Source of smORF | Transcriptional-level |
| Function | |
| Pubmed ID | 26536359 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 15 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2113144 | 2113191 | - | NC_015848.1 | Mycobacterium canettii CIPT 140010059 |
| 2 | 2074703 | 2074750 | - | NC_000962.3 | Mycobacterium tuberculosis H37Rv |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_015848.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF05949.14 | 1.0 | 2 | 2817.0 | opposite-strand | Bacterial protein of unknown function (DUF881) |
| 2 | PF01597.21 | 1.0 | 2 | 2375.0 | opposite-strand | Glycine cleavage H-protein |
| 3 | PF00498.28 | 1.0 | 2 | 1647.0 | opposite-strand | FHA domain |
| 4 | PF16697.7 | 1.0 | 2 | 1647.0 | opposite-strand | Inner membrane component of T3SS, cytoplasmic domain |
| 5 | PF00376.25 | 1.0 | 2 | 907.0 | opposite-strand | MerR family regulatory protein |
| 6 | PF13411.8 | 1.0 | 2 | 507.5 | opposite-strand | MerR HTH family regulatory protein |
| 7 | PF02577.16 | 1.0 | 2 | 294.0 | opposite-strand | Domain of unknown function (DUF151) |
| 8 | PF02347.18 | 1.0 | 2 | 1127.0 | opposite-strand | Glycine cleavage system P-protein |
| 9 | PF12697.9 | 1.0 | 2 | 4677.5 | both-strands | Alpha/beta hydrolase family |
| 10 | PF12146.10 | 1.0 | 2 | 4677.5 | both-strands | Serine aminopeptidase, S33 |
| 11 | PF00561.22 | 1.0 | 2 | 5179.0 | opposite-strand | alpha/beta hydrolase fold |
++ More..