Result : EXP02009

Protein Information

• Protein name: EXP02009
• NCBI Accession ID: NC_000962.3
• Organism: Mycobacterium tuberculosis H37Rv
• Left: 1984944
• Right: 1985024
• Strand: -
• Nucleotide Sequence: GTGGTCGGCATACAACGTGATGTTGATGCACACCGTGCTGCCATAGCCCCTGCGTTCGGACGCCGCTTGCGGTCCGCATGA
• Sequence: VVGIQRDVDAHRAAIAPAFGRRLRSA
• Source of smORF: Transcriptional-level
• Pubmed ID: 26536359
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 26

Conservation Analysis

No. of Species: 3

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	2019966	2020046	-	NC_015848.1	Mycobacterium canettii CIPT 140010059
2	1984944	1985024	-	NC_000962.3	Mycobacterium tuberculosis H37Rv
3	43972	44067	+	NZ_LR134363.1	Actinomyces slackii

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_015848.1

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF00501.30	0.67	2	5759.5	same-strand	AMP-binding enzyme
2	PF13193.8	0.67	2	5759.5	same-strand	AMP-binding enzyme C-terminal domain
3	PF01494.21	0.67	2	4323.5	opposite-strand	FAD binding domain
4	PF00823.21	0.67	2	169.0	same-strand	PPE family
5	PF01469.20	0.67	2	169.0	same-strand	Pentapeptide repeats (8 copies)
6	PF13810.8	0.67	2	-45.0	same-strand	Domain of unknown function (DUF4185)
7	PF00665.28	0.67	2	2415.5	same-strand	Integrase core domain
8	PF13276.8	0.67	2	2415.5	same-strand	HTH-like domain
9	PF13683.8	0.67	2	2415.5	same-strand	Integrase core domain